Incidental Mutation 'R3236:Aff2'
ID259072
Institutional Source Beutler Lab
Gene Symbol Aff2
Ensembl Gene ENSMUSG00000031189
Gene NameAF4/FMR2 family, member 2
SynonymsFmr2, Oxh, Ox19
MMRRC Submission 040618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3236 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location69360294-69868037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69863937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1175 (V1175E)
Ref Sequence ENSEMBL: ENSMUSP00000033532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033532
AA Change: V1175E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033532
Gene: ENSMUSG00000031189
AA Change: V1175E

DomainStartEndE-ValueType
Pfam:AF-4 18 372 2.3e-108 PFAM
Pfam:AF-4 363 1269 3.4e-265 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151662
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired conditioned fear responses and enhanced long-term potentiation in hippocampal slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
5730455P16Rik G A 11: 80,368,170 L255F probably damaging Het
9130011E15Rik A T 19: 45,975,283 probably benign Het
Agbl3 A G 6: 34,823,087 probably null Het
Atm T A 9: 53,479,748 D1842V probably benign Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccdc88a A G 11: 29,447,995 T243A possibly damaging Het
Col5a3 G T 9: 20,807,653 N268K unknown Het
Col6a1 G A 10: 76,711,320 T737M unknown Het
Cyp3a25 T C 5: 146,003,128 probably benign Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Ecm1 G T 3: 95,734,846 Q476K possibly damaging Het
Eml6 A G 11: 29,831,097 probably null Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm5478 A G 15: 101,644,303 Y398H probably damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hk1 T C 10: 62,296,019 probably null Het
Kdm6b A G 11: 69,406,366 Y387H probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lrig3 G A 10: 125,997,187 C310Y probably damaging Het
Map6 T A 7: 99,336,824 V645E probably damaging Het
Memo1 A T 17: 74,202,352 I224K probably damaging Het
Morc2a T C 11: 3,683,612 I602T probably benign Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Ndrg3 T A 2: 156,944,037 I161F probably damaging Het
Notch3 T C 17: 32,158,461 R214G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr116 T C 17: 37,624,236 E133G possibly damaging Het
Olfr1178 T C 2: 88,391,406 I53T probably benign Het
Pdgfra T C 5: 75,167,936 V243A probably damaging Het
Piwil4 A G 9: 14,700,248 probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pon2 A T 6: 5,266,986 N252K possibly damaging Het
Ptf1a T C 2: 19,445,907 F16S probably damaging Het
Rasgrp1 A G 2: 117,291,812 Y366H probably benign Het
Rbfox1 G A 16: 7,408,028 V353I possibly damaging Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf4 T A 16: 90,260,217 D82V unknown Het
Serhl C A 15: 83,104,403 P177Q probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Sf3b3 A G 8: 110,812,020 S1123P probably damaging Het
Slc1a3 T C 15: 8,639,123 I453V probably damaging Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Snrnp200 T A 2: 127,221,882 D660E probably damaging Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
Speer4e T A 5: 14,934,925 E206D possibly damaging Het
Stard6 T A 18: 70,500,486 M188K probably damaging Het
Stat6 G A 10: 127,652,222 V282I possibly damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Szt2 A C 4: 118,383,034 probably null Het
Thsd4 C A 9: 60,394,387 K208N probably benign Het
Thsd7b C T 1: 130,218,118 Q1588* probably null Het
Tmem167 C T 13: 90,104,380 R52C probably benign Het
Ttn T C 2: 76,899,409 probably benign Het
Usp39 G A 6: 72,338,389 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r24 C T 6: 123,779,025 Q19* probably null Het
Vps13b G A 15: 35,910,304 E3405K probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Aff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Aff2 APN X 69544593 missense possibly damaging 0.61
IGL01373:Aff2 APN X 69867729 missense possibly damaging 0.84
IGL02253:Aff2 APN X 69830791 missense probably benign 0.00
IGL02614:Aff2 APN X 69864087 missense possibly damaging 0.92
IGL03116:Aff2 APN X 69834486 missense probably benign 0.23
IGL03184:Aff2 APN X 69767234 missense possibly damaging 0.82
H8562:Aff2 UTSW X 69848926 missense unknown
LCD18:Aff2 UTSW X 69747535 intron probably benign
R0190:Aff2 UTSW X 69849105 frame shift probably null
R0481:Aff2 UTSW X 69834642 missense probably damaging 1.00
R0554:Aff2 UTSW X 69864074 missense possibly damaging 0.85
R2253:Aff2 UTSW X 69834803 missense possibly damaging 0.84
R3237:Aff2 UTSW X 69863937 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GACCAAAGAGATGTGGGCATTC -3'
(R):5'- GCATCCTCATCCTTAGGCAAAG -3'

Sequencing Primer
(F):5'- GTGGGCATTCATATGAAGTTTCACAC -3'
(R):5'- TCCTCATCCTTAGGCAAAGAATAG -3'
Posted On2015-01-23