Incidental Mutation 'R3237:Zfp804b'
ID259084
Institutional Source Beutler Lab
Gene Symbol Zfp804b
Ensembl Gene ENSMUSG00000092094
Gene Namezinc finger protein 804B
SynonymsLOC207618
MMRRC Submission 040619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R3237 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location6769010-7344756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6769239 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1275 (M1275V)
Ref Sequence ENSEMBL: ENSMUSP00000143568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164784] [ENSMUST00000200317]
Predicted Effect probably benign
Transcript: ENSMUST00000164784
AA Change: M1239V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130571
Gene: ENSMUSG00000092094
AA Change: M1239V

DomainStartEndE-ValueType
ZnF_C2H2 20 44 4.81e0 SMART
low complexity region 922 934 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
low complexity region 1160 1171 N/A INTRINSIC
low complexity region 1179 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200317
AA Change: M1275V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143568
Gene: ENSMUSG00000092094
AA Change: M1275V

DomainStartEndE-ValueType
ZnF_C2H2 56 80 2e-2 SMART
low complexity region 958 970 N/A INTRINSIC
low complexity region 1155 1179 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1215 1234 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccm2 G A 11: 6,570,090 V53I probably benign Het
Cd3e G T 9: 45,002,310 C42* probably null Het
Cd4 A T 6: 124,867,670 I384N probably benign Het
Ceacam11 T A 7: 17,973,454 F54L probably benign Het
Cfap46 A G 7: 139,617,590 S2122P probably damaging Het
Clptm1 A G 7: 19,635,346 S461P probably damaging Het
Dlat T C 9: 50,638,031 T518A possibly damaging Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Fam181a T G 12: 103,316,089 C84W possibly damaging Het
Fam198a C T 9: 121,964,869 P30S possibly damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Inpp5b A G 4: 124,780,486 R329G probably benign Het
Klrb1f A T 6: 129,054,343 I168L possibly damaging Het
Lama4 A T 10: 39,097,179 I1581F probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lyzl4 T C 9: 121,584,167 D65G probably benign Het
Med29 A G 7: 28,392,621 probably benign Het
Myrip C A 9: 120,441,407 D574E possibly damaging Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Nlrp9a A T 7: 26,571,385 K892* probably null Het
Nsd1 T A 13: 55,312,888 H2309Q possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Optn T C 2: 5,034,203 S370G probably damaging Het
Pbrm1 T C 14: 31,032,475 F151L probably damaging Het
Plekhs1 A T 19: 56,464,600 probably null Het
Rpn1 A G 6: 88,103,414 K565R probably benign Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr1 C T 7: 29,069,650 probably null Het
Scai C T 2: 39,150,314 probably benign Het
Scap C G 9: 110,379,582 P564A probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Slc41a3 T C 6: 90,636,865 Y226H probably benign Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Sned1 G A 1: 93,259,003 R180Q probably benign Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
St8sia3 T C 18: 64,269,815 F175S probably damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Syngap1 T A 17: 26,957,093 Y118* probably null Het
Szt2 A C 4: 118,383,034 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba3 G T 6: 97,186,240 T319K probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zc3hav1 A G 6: 38,319,715 L751S probably damaging Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Zfp804b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Zfp804b APN 5 6770931 missense probably damaging 1.00
IGL01726:Zfp804b APN 5 7180707 intron probably benign
IGL02020:Zfp804b APN 5 6769118 missense probably damaging 1.00
IGL02567:Zfp804b APN 5 6769989 missense probably benign 0.02
IGL02679:Zfp804b APN 5 6771392 missense possibly damaging 0.50
IGL03245:Zfp804b APN 5 6772253 missense possibly damaging 0.92
IGL03352:Zfp804b APN 5 6770039 missense probably benign 0.45
Flush UTSW 5 6770217 missense probably benign 0.27
gozinta UTSW 5 6770153 missense possibly damaging 0.90
healthy UTSW 5 6770013 missense probably benign 0.04
Paluka UTSW 5 6770534 missense probably benign
PIT4142001:Zfp804b UTSW 5 6769422 missense probably damaging 0.99
R0025:Zfp804b UTSW 5 6771665 missense probably damaging 1.00
R0044:Zfp804b UTSW 5 6769655 missense probably damaging 1.00
R0137:Zfp804b UTSW 5 6770534 missense probably benign
R0330:Zfp804b UTSW 5 6771029 missense possibly damaging 0.83
R0330:Zfp804b UTSW 5 6771994 missense possibly damaging 0.63
R0522:Zfp804b UTSW 5 6772014 missense probably benign 0.05
R1463:Zfp804b UTSW 5 7179372 intron probably benign
R1497:Zfp804b UTSW 5 6771105 missense probably damaging 0.97
R1511:Zfp804b UTSW 5 6769771 missense possibly damaging 0.87
R1633:Zfp804b UTSW 5 7179513 intron probably benign
R1666:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1668:Zfp804b UTSW 5 6771323 missense possibly damaging 0.93
R1677:Zfp804b UTSW 5 7179533 intron probably benign
R1698:Zfp804b UTSW 5 6769509 missense probably damaging 1.00
R1716:Zfp804b UTSW 5 6769673 missense probably benign 0.00
R1730:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1747:Zfp804b UTSW 5 6770217 missense probably benign 0.27
R1776:Zfp804b UTSW 5 6769806 missense probably damaging 1.00
R1783:Zfp804b UTSW 5 6771938 missense probably damaging 0.99
R1804:Zfp804b UTSW 5 6771756 missense possibly damaging 0.78
R1885:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1887:Zfp804b UTSW 5 6770376 missense probably damaging 0.97
R1900:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R1929:Zfp804b UTSW 5 6769748 missense probably benign 0.05
R2141:Zfp804b UTSW 5 6772583 missense probably benign 0.11
R2181:Zfp804b UTSW 5 6771674 missense probably damaging 1.00
R2401:Zfp804b UTSW 5 6769445 missense probably damaging 1.00
R2408:Zfp804b UTSW 5 7179410 intron probably benign
R3429:Zfp804b UTSW 5 7180625 intron probably benign
R3785:Zfp804b UTSW 5 6770153 missense possibly damaging 0.90
R4459:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4460:Zfp804b UTSW 5 6771481 missense probably damaging 0.99
R4608:Zfp804b UTSW 5 6772584 missense probably benign 0.04
R4762:Zfp804b UTSW 5 6772250 missense probably benign 0.00
R4871:Zfp804b UTSW 5 6876479 missense probably damaging 1.00
R4910:Zfp804b UTSW 5 6770540 missense possibly damaging 0.69
R4973:Zfp804b UTSW 5 6771198 missense probably damaging 0.99
R5199:Zfp804b UTSW 5 6770013 missense probably benign 0.04
R5219:Zfp804b UTSW 5 6770703 missense probably benign 0.01
R5411:Zfp804b UTSW 5 6770071 missense probably benign 0.00
R6001:Zfp804b UTSW 5 6769043 missense probably benign 0.00
R6041:Zfp804b UTSW 5 6771231 missense probably benign 0.08
R6151:Zfp804b UTSW 5 6769910 missense probably benign
R6252:Zfp804b UTSW 5 6769478 missense probably damaging 0.99
R6283:Zfp804b UTSW 5 6769908 missense probably benign 0.01
R6346:Zfp804b UTSW 5 6770534 missense probably benign
R6520:Zfp804b UTSW 5 6769283 missense probably damaging 0.99
R6714:Zfp804b UTSW 5 6769239 missense probably benign 0.00
R6924:Zfp804b UTSW 5 6769902 missense probably benign 0.09
R6966:Zfp804b UTSW 5 6771615 missense probably damaging 1.00
R7027:Zfp804b UTSW 5 6770372 missense probably benign
R7042:Zfp804b UTSW 5 6770042 missense probably benign 0.00
R7076:Zfp804b UTSW 5 6769751 missense probably benign 0.02
R7099:Zfp804b UTSW 5 6772161 missense probably benign 0.37
X0027:Zfp804b UTSW 5 6771257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACACTATTTAACTGTTGCATCTGG -3'
(R):5'- AGACAGTTCCAGTGCACCAG -3'

Sequencing Primer
(F):5'- AACTGTTGCATCTGGCTGGAG -3'
(R):5'- ACCACACATTTCTACAGCATTTTG -3'
Posted On2015-01-23