Incidental Mutation 'R3176:Olfr584'
ID259137
Institutional Source Beutler Lab
Gene Symbol Olfr584
Ensembl Gene ENSMUSG00000073959
Gene Nameolfactory receptor 584
SynonymsGA_x6K02T2PBJ9-5796876-5797820, MOR30-2
MMRRC Submission 040614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3176 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103081885-103088315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103085750 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 72 (D72E)
Ref Sequence ENSEMBL: ENSMUSP00000151043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098210] [ENSMUST00000211036] [ENSMUST00000214215]
Predicted Effect probably damaging
Transcript: ENSMUST00000098210
AA Change: D77E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095811
Gene: ENSMUSG00000073959
AA Change: D77E

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 1.4e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 234 2.1e-9 PFAM
Pfam:7tm_1 48 299 4.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211036
AA Change: D72E
Predicted Effect probably damaging
Transcript: ENSMUST00000214215
AA Change: D72E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Ces2a A G 8: 104,739,378 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dcp1a A G 14: 30,505,542 probably benign Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Dtx3l A G 16: 35,932,173 S688P probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Kif15 T C 9: 122,987,840 probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nbeal2 G A 9: 110,636,887 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Olfr584
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Olfr584 APN 7 103086375 missense probably benign 0.00
IGL02113:Olfr584 APN 7 103085850 missense possibly damaging 0.95
IGL02398:Olfr584 APN 7 103086106 missense probably damaging 1.00
IGL02718:Olfr584 APN 7 103085583 missense probably benign 0.01
IGL02941:Olfr584 APN 7 103086321 missense probably benign 0.05
IGL02942:Olfr584 APN 7 103086198 missense probably benign 0.07
R0496:Olfr584 UTSW 7 103085590 missense probably damaging 1.00
R0511:Olfr584 UTSW 7 103085851 missense probably damaging 1.00
R0646:Olfr584 UTSW 7 103086151 missense probably damaging 0.99
R1652:Olfr584 UTSW 7 103085806 missense probably benign 0.04
R2312:Olfr584 UTSW 7 103086426 missense probably damaging 0.99
R2849:Olfr584 UTSW 7 103086112 missense probably damaging 1.00
R2937:Olfr584 UTSW 7 103086341 missense probably benign 0.01
R3276:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3708:Olfr584 UTSW 7 103086294 missense probably damaging 1.00
R4737:Olfr584 UTSW 7 103085914 missense probably damaging 1.00
R5045:Olfr584 UTSW 7 103086457 missense probably benign 0.00
R5172:Olfr584 UTSW 7 103085677 missense probably damaging 1.00
R5849:Olfr584 UTSW 7 103085521 start codon destroyed probably null 0.02
R6294:Olfr584 UTSW 7 103085667 missense probably benign 0.01
R6846:Olfr584 UTSW 7 103086058 missense possibly damaging 0.88
R6869:Olfr584 UTSW 7 103085868 missense possibly damaging 0.47
R6936:Olfr584 UTSW 7 103085814 missense probably damaging 0.97
R7133:Olfr584 UTSW 7 103085998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGCTTGGAATCCCAGGAC -3'
(R):5'- CAGCACCTAGTTTGATGACTGC -3'

Sequencing Primer
(F):5'- GTGACTGGAAACATCACC -3'
(R):5'- CACCTAGTTTGATGACTGCAGATG -3'
Posted On2015-01-23