Incidental Mutation 'R3402:Prkcq'
ID 259212
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Name protein kinase C, theta
Synonyms A130035A12Rik, PKC-theta, PKC theta, PKC-0, Pkcq, PKCtheta
MMRRC Submission 040621-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3402 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 11176922-11306033 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11288660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 538 (T538A)
Ref Sequence ENSEMBL: ENSMUSP00000100035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
AlphaFold Q02111
Predicted Effect possibly damaging
Transcript: ENSMUST00000028118
AA Change: T538A

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: T538A

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102970
AA Change: T538A

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: T538A

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195628
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 A T 5: 89,849,592 (GRCm39) F609L probably benign Het
Adgrv1 T C 13: 81,691,661 (GRCm39) N1642S probably damaging Het
Afdn C T 17: 14,104,176 (GRCm39) R1156C probably damaging Het
Ark2c A G 18: 77,652,782 (GRCm39) V6A probably benign Het
Cactin G A 10: 81,161,709 (GRCm39) R747H probably benign Het
Col12a1 T C 9: 79,551,229 (GRCm39) E2129G probably damaging Het
Dennd4c C T 4: 86,692,780 (GRCm39) P97S probably damaging Het
Dnah3 A G 7: 119,566,879 (GRCm39) V2449A probably benign Het
Dysf G A 6: 84,163,491 (GRCm39) probably null Het
Etl4 A T 2: 20,786,693 (GRCm39) H763L probably damaging Het
Hip1r A G 5: 124,135,046 (GRCm39) E394G probably damaging Het
Ift25 A G 4: 107,130,803 (GRCm39) probably null Het
Kat2b C T 17: 53,972,881 (GRCm39) P732S probably damaging Het
Myo16 A G 8: 10,434,719 (GRCm39) N387S probably benign Het
Nlrp4d A T 7: 10,096,781 (GRCm39) N906K probably damaging Het
Or1ad6 A G 11: 50,859,895 (GRCm39) I17V probably benign Het
Or5b120 G A 19: 13,480,312 (GRCm39) A202T probably benign Het
Pkn1 G A 8: 84,396,859 (GRCm39) R926W probably damaging Het
Ppp1r37 C T 7: 19,266,712 (GRCm39) A392T probably damaging Het
Sel1l2 T A 2: 140,082,958 (GRCm39) Y560F probably damaging Het
Slc6a6 A G 6: 91,703,110 (GRCm39) H161R probably benign Het
Slit2 T C 5: 48,440,763 (GRCm39) Y1212H probably damaging Het
Stk3 G T 15: 34,945,144 (GRCm39) probably benign Het
Tcaf3 T C 6: 42,570,787 (GRCm39) S322G probably benign Het
Tma16 C T 8: 66,936,823 (GRCm39) probably null Het
Tmem74 C T 15: 43,730,417 (GRCm39) V209M probably damaging Het
Unc80 A T 1: 66,549,845 (GRCm39) E701V probably damaging Het
Upk3a T C 15: 84,902,384 (GRCm39) probably null Het
Zfp180 G A 7: 23,805,170 (GRCm39) V530I probably benign Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11,288,654 (GRCm39) missense probably damaging 1.00
IGL01656:Prkcq APN 2 11,231,766 (GRCm39) missense probably damaging 1.00
IGL01732:Prkcq APN 2 11,265,644 (GRCm39) splice site probably benign
IGL02136:Prkcq APN 2 11,265,479 (GRCm39) missense probably benign 0.00
IGL02161:Prkcq APN 2 11,281,887 (GRCm39) missense probably benign
IGL02178:Prkcq APN 2 11,281,851 (GRCm39) missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11,265,597 (GRCm39) missense probably damaging 1.00
IGL03149:Prkcq APN 2 11,237,356 (GRCm39) missense probably benign 0.11
banks UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
celina UTSW 2 11,288,660 (GRCm39) missense possibly damaging 0.82
celina2 UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
Megabytes UTSW 2 11,295,262 (GRCm39) nonsense probably null
Monmouth UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
3-1:Prkcq UTSW 2 11,304,905 (GRCm39) missense probably damaging 1.00
K3955:Prkcq UTSW 2 11,251,604 (GRCm39) splice site probably benign
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0049:Prkcq UTSW 2 11,288,643 (GRCm39) missense probably benign 0.04
R0183:Prkcq UTSW 2 11,257,973 (GRCm39) missense probably damaging 1.00
R0366:Prkcq UTSW 2 11,251,649 (GRCm39) splice site probably benign
R0388:Prkcq UTSW 2 11,259,045 (GRCm39) missense probably benign
R1385:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R1687:Prkcq UTSW 2 11,295,344 (GRCm39) missense probably damaging 1.00
R1693:Prkcq UTSW 2 11,259,010 (GRCm39) missense probably damaging 0.99
R1760:Prkcq UTSW 2 11,304,881 (GRCm39) missense probably damaging 1.00
R1764:Prkcq UTSW 2 11,237,442 (GRCm39) missense probably damaging 1.00
R1968:Prkcq UTSW 2 11,250,208 (GRCm39) missense probably damaging 1.00
R2020:Prkcq UTSW 2 11,284,332 (GRCm39) missense probably benign
R2108:Prkcq UTSW 2 11,237,380 (GRCm39) missense probably damaging 1.00
R2762:Prkcq UTSW 2 11,237,451 (GRCm39) missense possibly damaging 0.75
R3429:Prkcq UTSW 2 11,251,781 (GRCm39) missense probably damaging 1.00
R3545:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3547:Prkcq UTSW 2 11,288,627 (GRCm39) missense probably benign 0.11
R3893:Prkcq UTSW 2 11,231,782 (GRCm39) missense probably damaging 1.00
R4086:Prkcq UTSW 2 11,288,679 (GRCm39) missense probably damaging 0.97
R4423:Prkcq UTSW 2 11,260,980 (GRCm39) missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11,288,623 (GRCm39) missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11,284,333 (GRCm39) missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11,231,797 (GRCm39) critical splice donor site probably null
R5197:Prkcq UTSW 2 11,304,227 (GRCm39) missense probably damaging 1.00
R6008:Prkcq UTSW 2 11,261,097 (GRCm39) missense probably damaging 1.00
R7030:Prkcq UTSW 2 11,231,661 (GRCm39) splice site probably null
R7231:Prkcq UTSW 2 11,295,262 (GRCm39) nonsense probably null
R7461:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R7613:Prkcq UTSW 2 11,304,221 (GRCm39) missense probably damaging 1.00
R8441:Prkcq UTSW 2 11,253,037 (GRCm39) missense probably benign 0.11
R8491:Prkcq UTSW 2 11,284,335 (GRCm39) missense probably damaging 1.00
R8724:Prkcq UTSW 2 11,304,784 (GRCm39) missense probably benign 0.17
R9031:Prkcq UTSW 2 11,251,819 (GRCm39) missense probably damaging 0.99
R9164:Prkcq UTSW 2 11,231,716 (GRCm39) missense probably damaging 0.96
R9621:Prkcq UTSW 2 11,261,014 (GRCm39) missense probably benign 0.00
R9661:Prkcq UTSW 2 11,250,141 (GRCm39) nonsense probably null
Z1177:Prkcq UTSW 2 11,304,192 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGACACAGCTGCCACAC -3'
(R):5'- CACTCAAATGGAATCTAGTCACAG -3'

Sequencing Primer
(F):5'- TGCCACACCCCATGAGAATTTC -3'
(R):5'- TGTTAGTTGTAAAACTCAAAAGACCC -3'
Posted On 2015-01-23