Mutagenetix > Incidental Mutation

Incidental Mutation 'R3403:Asic3'

259250

Institutional Source

Beutler Lab

Gene Symbol

Asic3

Ensembl Gene

ENSMUSG00000038276

Gene Name

acid-sensing ion channel 3

Synonyms

Accn3, DRASIC

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R3403 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24618449-24622836 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24621985 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 415 (E415G)

Ref Sequence

ENSEMBL: ENSMUSP00000143083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030814] [ENSMUST00000049346] [ENSMUST00000196296] [ENSMUST00000198990]

AlphaFold

Q6X1Y6

Predicted Effect

probably benign
Transcript: ENSMUST00000030814

SMART Domains

Protein: ENSMUSP00000030814
Gene: ENSMUSG00000028969

Domain	Start	End	E-Value	Type
S_TKc	4	286	6.11e-101	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000049346
AA Change: K366E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000039914
Gene: ENSMUSG00000038276
AA Change: K366E

Domain	Start	End	E-Value	Type
Pfam:ASC	21	458	2.5e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196296
AA Change: E415G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143083
Gene: ENSMUSG00000038276
AA Change: E415G

Domain	Start	End	E-Value	Type
Pfam:ASC	21	459	4e-155	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197210

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197619

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198241

Predicted Effect

unknown
Transcript: ENSMUST00000198442
AA Change: E47G

Predicted Effect

probably benign
Transcript: ENSMUST00000198990

SMART Domains

Protein: ENSMUSP00000142413
Gene: ENSMUSG00000028969

Domain	Start	End	E-Value	Type
Pfam:Pkinase	4	101	9.7e-23	PFAM
Pfam:Pkinase_Tyr	4	102	2.7e-13	PFAM
Pfam:Pkinase	97	254	6.6e-30	PFAM
Pfam:Pkinase_Tyr	102	200	9.4e-6	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 2 has been observed as proton-gated channels sensitive to gadolinium. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced latency to onset of pain responses, increased sensitivity to light touch, but decreased sensitivity to noxious pinch and responses of acid- and noxious heat-sensitive nociceptors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	T	C	1: 78,673,839 (GRCm39)	V333A	probably damaging	Het
Afdn	C	T	17: 14,104,176 (GRCm39)	R1156C	probably damaging	Het
Cactin	G	A	10: 81,161,709 (GRCm39)	R747H	probably benign	Het
Calcr	T	A	6: 3,687,604 (GRCm39)	I465F	probably benign	Het
Dennd4c	C	T	4: 86,692,780 (GRCm39)	P97S	probably damaging	Het
Dnah3	A	G	7: 119,566,879 (GRCm39)	V2449A	probably benign	Het
Dsg1c	A	G	18: 20,403,407 (GRCm39)	N189D	probably damaging	Het
Dysf	G	A	6: 84,163,491 (GRCm39)		probably null	Het
Ndrg3	C	T	2: 156,790,208 (GRCm39)	V92M	probably damaging	Het
Or5ac20	G	C	16: 59,104,475 (GRCm39)	N128K	probably benign	Het
Pacs2	T	C	12: 113,014,570 (GRCm39)	S214P	probably damaging	Het
Rad51	T	A	2: 118,951,025 (GRCm39)		probably benign	Het
Rtn4	T	C	11: 29,657,690 (GRCm39)	S499P	probably benign	Het
Slc6a6	A	G	6: 91,703,110 (GRCm39)	H161R	probably benign	Het
Tma16	C	T	8: 66,936,823 (GRCm39)		probably null	Het
Tmem74	C	T	15: 43,730,417 (GRCm39)	V209M	probably damaging	Het
Unc80	A	T	1: 66,549,845 (GRCm39)	E701V	probably damaging	Het
Upk3a	T	C	15: 84,902,384 (GRCm39)		probably null	Het
Zhx1	T	C	15: 57,917,745 (GRCm39)	E167G	probably benign	Het

Other mutations in Asic3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01982:Asic3	APN	5	24,622,719 (GRCm39)	missense	probably benign	0.44
IGL02527:Asic3	APN	5	24,621,275 (GRCm39)	missense	probably benign	0.00
IGL02869:Asic3	APN	5	24,621,972 (GRCm39)	nonsense	probably null
E0370:Asic3	UTSW	5	24,618,985 (GRCm39)	missense	probably damaging	1.00
IGL03047:Asic3	UTSW	5	24,618,788 (GRCm39)	missense	probably benign
R0011:Asic3	UTSW	5	24,622,490 (GRCm39)	unclassified	probably benign
R0011:Asic3	UTSW	5	24,622,490 (GRCm39)	unclassified	probably benign
R0245:Asic3	UTSW	5	24,618,836 (GRCm39)	missense	probably damaging	1.00
R0270:Asic3	UTSW	5	24,622,700 (GRCm39)	missense	probably benign	0.01
R1464:Asic3	UTSW	5	24,618,819 (GRCm39)	missense	probably damaging	1.00
R1464:Asic3	UTSW	5	24,618,819 (GRCm39)	missense	probably damaging	1.00
R1702:Asic3	UTSW	5	24,620,454 (GRCm39)	missense	probably damaging	1.00
R1824:Asic3	UTSW	5	24,618,749 (GRCm39)	nonsense	probably null
R3722:Asic3	UTSW	5	24,621,997 (GRCm39)	missense	probably benign	0.08
R4383:Asic3	UTSW	5	24,618,932 (GRCm39)	missense	probably damaging	1.00
R4573:Asic3	UTSW	5	24,622,190 (GRCm39)	missense	probably damaging	1.00
R4794:Asic3	UTSW	5	24,620,895 (GRCm39)	missense	probably damaging	0.96
R6701:Asic3	UTSW	5	24,619,127 (GRCm39)	missense	possibly damaging	0.65
R7154:Asic3	UTSW	5	24,618,660 (GRCm39)	unclassified	probably benign
R7569:Asic3	UTSW	5	24,619,046 (GRCm39)	missense	probably benign	0.00
R7956:Asic3	UTSW	5	24,621,975 (GRCm39)	missense	possibly damaging	0.61
R9233:Asic3	UTSW	5	24,618,837 (GRCm39)	missense	probably damaging	1.00
R9564:Asic3	UTSW	5	24,620,875 (GRCm39)	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- ACATAACAGGTTCTGGGACTTGG -3'
(R):5'- CACAGAGGTAGTCGAGGATCTC -3'

Sequencing Primer
(F):5'- GACTTGGGCAAACTGCTTAAAC -3'
(R):5'- TAAGCAGGCTGGCTCCGATAAAC -3'

Posted On

2015-01-23