Incidental Mutation 'R3406:Cnga3'
ID259362
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Namecyclic nucleotide gated channel alpha 3
SynonymsCNG3
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3406 (G1)
Quality Score209
Status Validated
Chromosome1
Chromosomal Location37214434-37263384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37262065 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 622 (E622G)
Ref Sequence ENSEMBL: ENSMUSP00000142075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
Predicted Effect probably benign
Transcript: ENSMUST00000027288
AA Change: E622G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: E622G

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000194195
AA Change: E622G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: E622G

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000195272
AA Change: E660G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: E660G

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37260793 missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37244918 nonsense probably null
IGL02475:Cnga3 APN 1 37257991 critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37261674 missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37260985 missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37244828 splice site probably benign
R1678:Cnga3 UTSW 1 37261498 missense possibly damaging 0.94
R1938:Cnga3 UTSW 1 37261873 missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R3694:Cnga3 UTSW 1 37261740 missense probably damaging 1.00
R4079:Cnga3 UTSW 1 37241865 missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37258006 nonsense probably null
R4907:Cnga3 UTSW 1 37241942 critical splice donor site probably null
R5802:Cnga3 UTSW 1 37260925 missense probably damaging 0.98
R6135:Cnga3 UTSW 1 37232237 start gained probably benign
R6586:Cnga3 UTSW 1 37261278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGATGAGGACCTAGTCGCG -3'
(R):5'- GGAGAGGAAACTAAGGCTCTTCC -3'

Sequencing Primer
(F):5'- TCGCGGCCAGGGTAGATAC -3'
(R):5'- AGGCTCTTCCTTGCTGTCACAC -3'
Posted On2015-01-23