Incidental Mutation 'R3406:Abhd18'
ID259372
Institutional Source Beutler Lab
Gene Symbol Abhd18
Ensembl Gene ENSMUSG00000037818
Gene Nameabhydrolase domain containing 18
Synonyms3110057O12Rik
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3406 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40846970-40938138 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 40904903 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000124430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099123] [ENSMUST00000108077] [ENSMUST00000108078] [ENSMUST00000159774] [ENSMUST00000203214] [ENSMUST00000203472] [ENSMUST00000203650] [ENSMUST00000203892] [ENSMUST00000204496] [ENSMUST00000205065]
Predicted Effect probably benign
Transcript: ENSMUST00000099123
SMART Domains Protein: ENSMUSP00000141045
Gene: ENSMUSG00000074619

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:FUN14 81 183 2.9e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108077
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103712
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108078
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103713
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159774
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124430
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 1.3e-171 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203214
AA Change: M1K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144946
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 62 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203472
SMART Domains Protein: ENSMUSP00000145313
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 1 75 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203650
SMART Domains Protein: ENSMUSP00000145006
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 1 130 8.8e-71 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203892
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145150
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204496
AA Change: M1K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145007
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 67 2.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205065
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145095
Gene: ENSMUSG00000037818
AA Change: M1K

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Abhd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Abhd18 APN 3 40933642 missense probably benign 0.00
IGL01785:Abhd18 APN 3 40905904 missense probably damaging 1.00
IGL02318:Abhd18 APN 3 40930227 critical splice donor site probably null
IGL02447:Abhd18 APN 3 40933773 missense probably benign
IGL02823:Abhd18 APN 3 40933518 splice site probably benign
IGL03023:Abhd18 APN 3 40904984 missense probably damaging 0.98
F2404:Abhd18 UTSW 3 40933878 missense probably damaging 0.99
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0494:Abhd18 UTSW 3 40916688 missense probably damaging 1.00
R1994:Abhd18 UTSW 3 40934926 nonsense probably null
R2206:Abhd18 UTSW 3 40910573 missense probably benign 0.00
R2223:Abhd18 UTSW 3 40934861 splice site probably benign
R2698:Abhd18 UTSW 3 40930966 missense probably benign 0.03
R3747:Abhd18 UTSW 3 40933573 missense probably benign
R4899:Abhd18 UTSW 3 40905869 splice site probably null
R5259:Abhd18 UTSW 3 40916890 missense probably damaging 1.00
R5673:Abhd18 UTSW 3 40923451 missense probably damaging 1.00
R5713:Abhd18 UTSW 3 40934979 nonsense probably null
R5797:Abhd18 UTSW 3 40933551 missense probably benign 0.08
R5983:Abhd18 UTSW 3 40910544 missense probably damaging 1.00
R6333:Abhd18 UTSW 3 40933783 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGAAGTCATTGTTTGGTAAGGC -3'
(R):5'- ACCCAAGTCATGATGCTATATGC -3'

Sequencing Primer
(F):5'- AAGTCATTGTTTGGTAAGGCTTTAG -3'
(R):5'- TAACTCAGAGCACTTGTGGC -3'
Posted On2015-01-23