Incidental Mutation 'R3406:Nek8'
ID259390
Institutional Source Beutler Lab
Gene Symbol Nek8
Ensembl Gene ENSMUSG00000017405
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 8
Synonyms
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R3406 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78166106-78176675 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 78170746 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 319 (S319*)
Ref Sequence ENSEMBL: ENSMUSP00000017549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017549] [ENSMUST00000148154]
Predicted Effect probably null
Transcript: ENSMUST00000017549
AA Change: S319*
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405
AA Change: S319*

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147798
Predicted Effect probably benign
Transcript: ENSMUST00000148154
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152611
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a NIMA-related kinase. Members of this serine/threonine protein kinase family are structurally-related to NIMA (never in mitosis, gene A) which controls mitotic signaling in Aspergillus nidulans. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display kidney cysts primarily in the cortex, progressive kidney enlargement, increased serum creatinine levels, impaired maternal nurturing, and premature death. Heterotaxy with congenital heart disease such as hypoplastic right ventricle and small tricuspid valve is seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Nek8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nek8 APN 11 78167827 missense probably damaging 0.96
IGL00914:Nek8 APN 11 78173075 missense possibly damaging 0.80
nerkkod UTSW 11 78173059 missense probably damaging 1.00
R0136:Nek8 UTSW 11 78171207 missense probably benign 0.01
R0490:Nek8 UTSW 11 78167729 missense probably benign 0.01
R0657:Nek8 UTSW 11 78171207 missense probably benign 0.01
R1033:Nek8 UTSW 11 78171285 missense probably null 1.00
R2848:Nek8 UTSW 11 78168141 missense probably damaging 1.00
R4211:Nek8 UTSW 11 78170483 missense probably benign
R4810:Nek8 UTSW 11 78167803 missense probably benign 0.00
R4811:Nek8 UTSW 11 78167718 splice site probably null
R5108:Nek8 UTSW 11 78172527 missense probably damaging 0.96
R5124:Nek8 UTSW 11 78172939 missense probably damaging 1.00
R5177:Nek8 UTSW 11 78170471 nonsense probably null
R5212:Nek8 UTSW 11 78172516 start codon destroyed probably null 0.02
R5386:Nek8 UTSW 11 78170437 unclassified probably null
R5921:Nek8 UTSW 11 78173059 missense probably damaging 1.00
R5977:Nek8 UTSW 11 78167825 missense probably benign 0.01
X0026:Nek8 UTSW 11 78168105 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTCCTGAGAACCTTGCTGG -3'
(R):5'- TGAGGCCCCTTTGTATTCCG -3'

Sequencing Primer
(F):5'- TGAGAACCTTGCTGGGCTCC -3'
(R):5'- AGGACCACCTATAGCCTCTGG -3'
Posted On2015-01-23