Incidental Mutation 'R3406:Gsdma'
ID259391
Institutional Source Beutler Lab
Gene Symbol Gsdma
Ensembl Gene ENSMUSG00000017204
Gene Namegasdermin A
SynonymsGsdm1, H312E, Gsdm, Gsdma1
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R3406 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98664351-98677708 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 98673138 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017348]
Predicted Effect probably benign
Transcript: ENSMUST00000017348
SMART Domains Protein: ENSMUSP00000017348
Gene: ENSMUSG00000017204

DomainStartEndE-ValueType
Pfam:Gasdermin 3 421 2.2e-147 PFAM
low complexity region 429 443 N/A INTRINSIC
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Gsdma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Gsdma APN 11 98673687 missense probably damaging 0.98
IGL02573:Gsdma APN 11 98670751 splice site probably benign
IGL03005:Gsdma APN 11 98676259 missense probably damaging 0.97
R0143:Gsdma UTSW 11 98666254 missense probably damaging 0.96
R1337:Gsdma UTSW 11 98669707 nonsense probably null
R1533:Gsdma UTSW 11 98676384 missense unknown
R1605:Gsdma UTSW 11 98666493 missense probably damaging 0.98
R1929:Gsdma UTSW 11 98671367 critical splice donor site probably null
R1998:Gsdma UTSW 11 98673694 missense probably damaging 0.99
R2043:Gsdma UTSW 11 98666220 missense possibly damaging 0.94
R2114:Gsdma UTSW 11 98673012 missense probably damaging 1.00
R3404:Gsdma UTSW 11 98673138 splice site probably benign
R3405:Gsdma UTSW 11 98673138 splice site probably benign
R3711:Gsdma UTSW 11 98666219 nonsense probably null
R3764:Gsdma UTSW 11 98670767 missense probably damaging 0.98
R4656:Gsdma UTSW 11 98673081 missense probably damaging 1.00
R5384:Gsdma UTSW 11 98666449 critical splice acceptor site probably null
R5943:Gsdma UTSW 11 98673026 missense probably benign 0.30
X0017:Gsdma UTSW 11 98666270 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCTACAGAACGTTCAGGG -3'
(R):5'- GCTCTTCTTTCAGGGATAAAAGGG -3'

Sequencing Primer
(F):5'- CATCAGCTGAAAGGGTGCC -3'
(R):5'- TTCTTTCAGGGATAAAAGGGGGCAG -3'
Posted On2015-01-23