Incidental Mutation 'R3406:Rbfox3'
ID259393
Institutional Source Beutler Lab
Gene Symbol Rbfox3
Ensembl Gene ENSMUSG00000025576
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 3
SynonymsD11Bwg0517e, NeuN, Neuna60, Hrnbp3
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R3406 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118489762-118911597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118496457 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 277 (Q277L)
Ref Sequence ENSEMBL: ENSMUSP00000113636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000120061] [ENSMUST00000154746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017576
AA Change: Q277L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576
AA Change: Q277L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069343
AA Change: Q246L

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576
AA Change: Q246L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103023
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106278
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117731
AA Change: Q277L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576
AA Change: Q277L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120061
SMART Domains Protein: ENSMUSP00000113987
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 6.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154746
SMART Domains Protein: ENSMUSP00000118332
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
RRM 1 54 8.6e-5 SMART
Pfam:Fox-1_C 90 142 5.5e-16 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced brain weight, increased susceptibility kainic acid-induced seizures, decreased anxiety-related behaviors, and deficits in synaptic transmission and plasticity in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Rbfox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rbfox3 APN 11 118505613 splice site probably benign
IGL01622:Rbfox3 APN 11 118505614 splice site probably benign
IGL01623:Rbfox3 APN 11 118505614 splice site probably benign
IGL01716:Rbfox3 APN 11 118513289 missense possibly damaging 0.89
IGL01772:Rbfox3 APN 11 118496971 missense probably damaging 0.98
IGL03162:Rbfox3 APN 11 118496431 missense probably benign 0.06
R0267:Rbfox3 UTSW 11 118495240 missense probably benign 0.00
R1659:Rbfox3 UTSW 11 118494155 missense probably damaging 0.99
R1681:Rbfox3 UTSW 11 118505669 missense probably damaging 1.00
R1698:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R1731:Rbfox3 UTSW 11 118496936 critical splice donor site probably null
R2134:Rbfox3 UTSW 11 118497016 missense probably damaging 1.00
R2249:Rbfox3 UTSW 11 118503738 missense probably damaging 0.99
R3051:Rbfox3 UTSW 11 118502888 missense probably damaging 1.00
R3404:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3405:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R5276:Rbfox3 UTSW 11 118496352 missense probably damaging 1.00
X0013:Rbfox3 UTSW 11 118497041 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAGATGCCATGGGTCTATGTGC -3'
(R):5'- CTCTACTGCTGAAGAGGACAG -3'

Sequencing Primer
(F):5'- GAAGGGCAGACGGACTTCTC -3'
(R):5'- CTGAAGAGGACAGCTGCCTG -3'
Posted On2015-01-23