Incidental Mutation 'R3406:Lamb1'
ID259394
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Namelaminin B1
SynonymsC80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3406 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31265234-31329644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31287529 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 372 (R372C)
Ref Sequence ENSEMBL: ENSMUSP00000132778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
PDB Structure
Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000002979
AA Change: R420C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: R420C

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164919
AA Change: R420C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132616
Gene: ENSMUSG00000002900
AA Change: R420C

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169065
Predicted Effect probably damaging
Transcript: ENSMUST00000169088
AA Change: R372C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: R372C

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31298826 missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31302927 missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31301064 missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31320931 missense probably benign 0.09
IGL01470:Lamb1 APN 12 31300262 missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31306977 missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31329435 missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31300251 missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31305769 missense probably benign 0.00
IGL02365:Lamb1 APN 12 31318345 missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31320908 missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31318467 missense probably benign 0.05
IGL03132:Lamb1 APN 12 31300334 splice site probably null
IGL03161:Lamb1 APN 12 31326256 missense probably benign 0.41
IGL03169:Lamb1 APN 12 31323646 missense probably damaging 1.00
E0374:Lamb1 UTSW 12 31287930 missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31278621 missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31301156 missense probably benign 0.04
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31326645 nonsense probably null
R0456:Lamb1 UTSW 12 31304730 missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31326269 missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31282721 missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31282695 missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31298915 missense probably benign 0.02
R1500:Lamb1 UTSW 12 31298949 missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31278652 critical splice donor site probably null
R1772:Lamb1 UTSW 12 31278525 missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31301094 missense probably benign 0.00
R1853:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31329210 missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31287429 missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31318467 nonsense probably null
R2268:Lamb1 UTSW 12 31327645 missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31269055 critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31298883 missense probably benign 0.10
R3121:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31287910 missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3726:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3949:Lamb1 UTSW 12 31282649 missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31329255 missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31323529 missense probably benign 0.00
R4604:Lamb1 UTSW 12 31278776 missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31266848 nonsense probably null
R4710:Lamb1 UTSW 12 31282583 missense probably benign 0.02
R4767:Lamb1 UTSW 12 31308011 missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31278526 missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31298930 missense probably benign
R4842:Lamb1 UTSW 12 31287433 missense probably damaging 1.00
R4864:Lamb1 UTSW 12 31321006 missense probably benign 0.01
R4909:Lamb1 UTSW 12 31288281 missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31326678 missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31298909 missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31302665 nonsense probably null
R5766:Lamb1 UTSW 12 31299931 missense probably damaging 1.00
R5825:Lamb1 UTSW 12 31318614 missense probably benign
R5840:Lamb1 UTSW 12 31266756 missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31298955 missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31266864 nonsense probably null
R5984:Lamb1 UTSW 12 31327774 missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31269147 missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31282716 missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31323462 missense possibly damaging 0.63
X0054:Lamb1 UTSW 12 31287434 missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31303042 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACACGCTCTGTTCAGTGAG -3'
(R):5'- TACAACACAGGCTACGCTGC -3'

Sequencing Primer
(F):5'- GCCACATCTGCCCTGCATTG -3'
(R):5'- ACAGGCTACGCTGCTCAGAG -3'
Posted On2015-01-23