Incidental Mutation 'R3406:Stap2'
ID259406
Institutional Source Beutler Lab
Gene Symbol Stap2
Ensembl Gene ENSMUSG00000038781
Gene Namesignal transducing adaptor family member 2
SynonymsSTAP-2
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3406 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55997081-56005570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55997511 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 374 (W374R)
Ref Sequence ENSEMBL: ENSMUSP00000038130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably benign
Transcript: ENSMUST00000011733
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
AA Change: W374R

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781
AA Change: W374R

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Meta Mutation Damage Score 0.1656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the substrate of breast tumor kinase, an Src-type non-receptor tyrosine kinase. The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no apparent abnormalities in most organs at the gross and histological level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Stap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01578:Stap2 APN 17 55997623 missense probably benign 0.00
IGL02087:Stap2 APN 17 56005473 missense probably damaging 1.00
IGL02876:Stap2 APN 17 55999961 missense probably benign 0.00
IGL03101:Stap2 APN 17 56002029 missense probably damaging 1.00
R0033:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R0345:Stap2 UTSW 17 56000097 missense probably damaging 0.98
R3405:Stap2 UTSW 17 55997511 missense probably benign 0.30
R3929:Stap2 UTSW 17 56003156 missense probably damaging 1.00
R4210:Stap2 UTSW 17 55997827 nonsense probably null
R4543:Stap2 UTSW 17 55997604 critical splice donor site probably null
R4934:Stap2 UTSW 17 55997901 missense possibly damaging 0.69
R5748:Stap2 UTSW 17 56000475 splice site probably null
R6228:Stap2 UTSW 17 55999976 missense probably damaging 1.00
R6617:Stap2 UTSW 17 55999746 missense probably benign
Z1088:Stap2 UTSW 17 55999748 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCAGCTCAGCGGTGATATC -3'
(R):5'- AGCACCCTGTGACATCTCTC -3'

Sequencing Primer
(F):5'- GTGATATCCCCAAGTCCTGGTG -3'
(R):5'- GCAGTGTCTCTCTCCAGTCAGG -3'
Posted On2015-01-23