Mutagenetix > Incidental Mutations

Incidental Mutation 'R3708:Pappa2'

259421

Institutional Source

Beutler Lab

Gene Symbol

Pappa2

Ensembl Gene

ENSMUSG00000073530

Gene Name

pappalysin 2

Synonyms

pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe

MMRRC Submission

040701-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3708 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158711727-158980490 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 158834918 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1162 (Y1162*)

Ref Sequence

ENSEMBL: ENSMUSP00000124022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159861]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159860

Predicted Effect

probably null
Transcript: ENSMUST00000159861
AA Change: Y1162*

SMART Domains

Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: Y1162*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Laminin_G_3	271	440	1.2e-25	PFAM
NL	572	614	2.81e-5	SMART
Pfam:Peptidase_M43	669	832	1.5e-12	PFAM
Blast:FN3	844	1103	1e-169	BLAST
low complexity region	1130	1139	N/A	INTRINSIC
low complexity region	1361	1370	N/A	INTRINSIC
CCP	1394	1457	4.97e0	SMART
CCP	1462	1519	4.81e-1	SMART
CCP	1523	1588	2.58e-4	SMART
CCP	1593	1644	1.13e0	SMART
NL	1720	1757	2.66e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160206

Meta Mutation Damage Score

0.664

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 92.1%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
1700123L14Rik	G	A	6: 96,165,952	T37I	possibly damaging	Het
Abcc5	G	T	16: 20,372,180	Q807K	probably benign	Het
Amfr	T	C	8: 93,983,320	H419R	probably benign	Het
Atp8b2	A	T	3: 89,945,152	F866I	probably damaging	Het
Atxn7l3	G	A	11: 102,291,879		probably benign	Het
Bcs1l	A	G	1: 74,590,105		probably benign	Het
Card11	G	A	5: 140,887,135	R608C	probably damaging	Het
Celf2	C	A	2: 6,624,678	K137N	probably damaging	Het
Cmya5	A	T	13: 93,095,366	Y1071*	probably null	Het
Cyp2d10	A	G	15: 82,403,016	F469L	possibly damaging	Het
Cyp3a41a	A	G	5: 145,717,923		probably null	Het
Dnah8	A	T	17: 30,739,657	I2158L	probably damaging	Het
Dtnb	T	A	12: 3,589,156		probably null	Het
Dync1h1	T	C	12: 110,643,129	F2782L	probably damaging	Het
Ednrb	A	G	14: 103,817,080	Y439H	probably damaging	Het
Ferd3l	T	C	12: 33,928,749	V87A	probably benign	Het
Gphn	T	A	12: 78,532,693	S320T	probably benign	Het
Gpr39	C	T	1: 125,872,612	H367Y	probably damaging	Het
Hspa4l	A	T	3: 40,781,693	N582I	possibly damaging	Het
Ighv1-85	A	T	12: 116,000,216	W55R	probably damaging	Het
Lelp1	A	C	3: 92,135,407	C112G	unknown	Het
Lrba	A	G	3: 86,285,024	M82V	possibly damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Map2	A	T	1: 66,416,555		probably benign	Het
Ncor1	T	C	11: 62,344,687	K647R	probably damaging	Het
Nr4a3	A	T	4: 48,056,699	Y417F	probably damaging	Het
Obox7	C	A	7: 14,664,197	S54*	probably null	Het
Olfr1016	T	A	2: 85,799,998	I91L	probably benign	Het
Olfr135	A	G	17: 38,208,283	I13V	probably benign	Het
Olfr584	T	G	7: 103,086,294	Y254D	probably damaging	Het
Olfr888	T	C	9: 38,109,444	S253P	probably damaging	Het
Pcdhb19	T	A	18: 37,497,389	I79K	probably benign	Het
Pi4k2a	C	T	19: 42,090,931	Q144*	probably null	Het
Pigc	T	A	1: 161,971,094	M215K	probably benign	Het
Pnmal1	T	A	7: 16,960,225	S2T	probably damaging	Het
Ppfia4	T	C	1: 134,309,660	E967G	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rims3	A	G	4: 120,883,155	T100A	probably damaging	Het
Serpinb9	A	T	13: 33,008,019	N61I	possibly damaging	Het
Sis	A	G	3: 72,943,523	M614T	probably benign	Het
Slc6a17	C	T	3: 107,493,085	V243I	probably benign	Het
Smad9	A	T	3: 54,786,181	Y177F	probably benign	Het
Vmn2r69	T	C	7: 85,411,821	D185G	probably damaging	Het
Vps36	G	T	8: 22,192,883	V5L	probably benign	Het
Vwa8	T	A	14: 79,062,696		probably benign	Het

Other mutations in Pappa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Pappa2	APN	1	158857148	missense	probably damaging	1.00
IGL01394:Pappa2	APN	1	158765104	splice site	probably benign
IGL01570:Pappa2	APN	1	158814540	nonsense	probably null
IGL01618:Pappa2	APN	1	158857378	missense	probably damaging	1.00
IGL01717:Pappa2	APN	1	158857132	critical splice donor site	probably null
IGL01804:Pappa2	APN	1	158936519	missense	probably benign
IGL01904:Pappa2	APN	1	158783941	missense	probably damaging	0.99
IGL02116:Pappa2	APN	1	158845125	missense	probably benign	0.01
IGL02174:Pappa2	APN	1	158761618	missense	probably damaging	1.00
IGL02302:Pappa2	APN	1	158715001	missense	probably benign	0.38
IGL02422:Pappa2	APN	1	158936933	missense	probably damaging	1.00
IGL02572:Pappa2	APN	1	158851216	missense	probably benign
IGL02659:Pappa2	APN	1	158936794	missense	probably damaging	0.97
IGL02887:Pappa2	APN	1	158782259	missense	probably damaging	1.00
IGL02981:Pappa2	APN	1	158851144	missense	probably benign	0.00
IGL03128:Pappa2	APN	1	158936484	missense	probably benign	0.16
IGL03142:Pappa2	APN	1	158854931	missense	probably damaging	1.00
IGL03270:Pappa2	APN	1	158765067	missense	possibly damaging	0.78
Gulliver	UTSW	1	158857136	missense	probably null	1.00
Lilliputian	UTSW	1	158716990	missense	probably damaging	1.00
Lilliputian2	UTSW	1	158834918	nonsense	probably null
lilliputian3	UTSW	1	158782403	splice site	probably null
Pitzel	UTSW	1	158956645	missense	probably damaging	1.00
R0106:Pappa2	UTSW	1	158714977	missense	probably damaging	1.00
R0106:Pappa2	UTSW	1	158714977	missense	probably damaging	1.00
R0172:Pappa2	UTSW	1	158854849	critical splice donor site	probably null
R0194:Pappa2	UTSW	1	158765101	splice site	probably benign
R0418:Pappa2	UTSW	1	158716990	missense	probably damaging	1.00
R0421:Pappa2	UTSW	1	158848080	missense	probably damaging	1.00
R0441:Pappa2	UTSW	1	158763058	unclassified	probably benign
R0602:Pappa2	UTSW	1	158763055	unclassified	probably benign
R0630:Pappa2	UTSW	1	158832773	missense	probably benign
R0760:Pappa2	UTSW	1	158716961	critical splice donor site	probably null
R1146:Pappa2	UTSW	1	158854982	missense	probably damaging	1.00
R1146:Pappa2	UTSW	1	158854982	missense	probably damaging	1.00
R1243:Pappa2	UTSW	1	158845100	missense	probably damaging	1.00
R1413:Pappa2	UTSW	1	158936554	missense	probably benign	0.00
R1502:Pappa2	UTSW	1	158957288	missense	probably damaging	1.00
R1599:Pappa2	UTSW	1	158857172	missense	probably damaging	1.00
R1689:Pappa2	UTSW	1	158957398	missense	probably damaging	1.00
R1750:Pappa2	UTSW	1	158763150	nonsense	probably null
R1772:Pappa2	UTSW	1	158814368	missense	possibly damaging	0.92
R1832:Pappa2	UTSW	1	158857316	missense	probably damaging	1.00
R1905:Pappa2	UTSW	1	158803503	splice site	probably null
R1914:Pappa2	UTSW	1	158750563	missense	probably damaging	0.97
R2013:Pappa2	UTSW	1	158834928	missense	probably damaging	1.00
R2037:Pappa2	UTSW	1	158956644	nonsense	probably null
R2118:Pappa2	UTSW	1	158857266	missense	probably damaging	1.00
R2268:Pappa2	UTSW	1	158857271	missense	probably damaging	1.00
R2269:Pappa2	UTSW	1	158857271	missense	probably damaging	1.00
R2347:Pappa2	UTSW	1	158765043	missense	probably damaging	1.00
R3024:Pappa2	UTSW	1	158936225	missense	probably benign	0.00
R3706:Pappa2	UTSW	1	158834918	nonsense	probably null
R3707:Pappa2	UTSW	1	158834918	nonsense	probably null
R4600:Pappa2	UTSW	1	158814445	missense	probably damaging	1.00
R4737:Pappa2	UTSW	1	158957012	missense	probably benign
R4738:Pappa2	UTSW	1	158957012	missense	probably benign
R4739:Pappa2	UTSW	1	158957002	missense	probably damaging	0.99
R4739:Pappa2	UTSW	1	158957012	missense	probably benign
R4788:Pappa2	UTSW	1	158783917	missense	possibly damaging	0.86
R4798:Pappa2	UTSW	1	158857379	missense	probably damaging	0.99
R4952:Pappa2	UTSW	1	158857136	missense	probably null	1.00
R5121:Pappa2	UTSW	1	158838627	missense	probably benign	0.01
R5144:Pappa2	UTSW	1	158957133	missense	probably benign	0.03
R5159:Pappa2	UTSW	1	158761619	missense	probably damaging	1.00
R5278:Pappa2	UTSW	1	158782403	splice site	probably null
R5428:Pappa2	UTSW	1	158814785	missense	possibly damaging	0.53
R5452:Pappa2	UTSW	1	158838602	missense	probably benign	0.00
R5477:Pappa2	UTSW	1	158956738	missense	probably benign	0.00
R5504:Pappa2	UTSW	1	158848045	missense	probably benign	0.00
R5852:Pappa2	UTSW	1	158717014	missense	probably damaging	1.00
R6003:Pappa2	UTSW	1	158936250	missense	probably benign	0.23
R6129:Pappa2	UTSW	1	158714997	nonsense	probably null
R6137:Pappa2	UTSW	1	158871543	missense	probably damaging	1.00
R6374:Pappa2	UTSW	1	158956645	missense	probably damaging	1.00
R6472:Pappa2	UTSW	1	158834799	missense	probably damaging	1.00
R6804:Pappa2	UTSW	1	158936868	missense	probably benign	0.24
X0058:Pappa2	UTSW	1	158814397	missense	probably null
X0061:Pappa2	UTSW	1	158936618	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AGCCATGACTCCATTCTTCTGG -3'
(R):5'- CTGCTTCTTCCCTCATAAAGAGTG -3'

Sequencing Primer
(F):5'- CTGGCTTAACTTACCATTGAATGAGG -3'
(R):5'- TCTTCCCTCATAAAGAGTGAAAAAC -3'

Posted On

2015-01-23