Incidental Mutation 'R3708:1700123L14Rik'
List |< first << previous [record 93 of 32981] next >> last >|
ID259438
Institutional Source Beutler Lab
Gene Symbol 1700123L14Rik
Ensembl Gene ENSMUSG00000072878
Gene NameRIKEN cDNA 1700123L14 gene
Synonyms
MMRRC Submission 040701-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R3708 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location96164497-96166243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96165952 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 37 (T37I)
Ref Sequence ENSEMBL: ENSMUSP00000087515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000090061] [ENSMUST00000122120]
Predicted Effect probably benign
Transcript: ENSMUST00000075080
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090061
AA Change: T37I

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087515
Gene: ENSMUSG00000072878
AA Change: T37I

DomainStartEndE-ValueType
Pfam:NUP50 2 73 1.8e-15 PFAM
low complexity region 84 94 N/A INTRINSIC
RanBD 315 438 2.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122120
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.1%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc5 G T 16: 20,372,180 Q807K probably benign Het
Amfr T C 8: 93,983,320 H419R probably benign Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn7l3 G A 11: 102,291,879 probably benign Het
Bcs1l A G 1: 74,590,105 probably benign Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Celf2 C A 2: 6,624,678 K137N probably damaging Het
Cmya5 A T 13: 93,095,366 Y1071* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Cyp3a41a A G 5: 145,717,923 probably null Het
Dnah8 A T 17: 30,739,657 I2158L probably damaging Het
Dtnb T A 12: 3,589,156 probably null Het
Dync1h1 T C 12: 110,643,129 F2782L probably damaging Het
Ednrb A G 14: 103,817,080 Y439H probably damaging Het
Ferd3l T C 12: 33,928,749 V87A probably benign Het
Gphn T A 12: 78,532,693 S320T probably benign Het
Gpr39 C T 1: 125,872,612 H367Y probably damaging Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Lrba A G 3: 86,285,024 M82V possibly damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Map2 A T 1: 66,416,555 probably benign Het
Ncor1 T C 11: 62,344,687 K647R probably damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Obox7 C A 7: 14,664,197 S54* probably null Het
Olfr1016 T A 2: 85,799,998 I91L probably benign Het
Olfr135 A G 17: 38,208,283 I13V probably benign Het
Olfr584 T G 7: 103,086,294 Y254D probably damaging Het
Olfr888 T C 9: 38,109,444 S253P probably damaging Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pcdhb19 T A 18: 37,497,389 I79K probably benign Het
Pi4k2a C T 19: 42,090,931 Q144* probably null Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pnmal1 T A 7: 16,960,225 S2T probably damaging Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims3 A G 4: 120,883,155 T100A probably damaging Het
Serpinb9 A T 13: 33,008,019 N61I possibly damaging Het
Sis A G 3: 72,943,523 M614T probably benign Het
Slc6a17 C T 3: 107,493,085 V243I probably benign Het
Smad9 A T 3: 54,786,181 Y177F probably benign Het
Vmn2r69 T C 7: 85,411,821 D185G probably damaging Het
Vps36 G T 8: 22,192,883 V5L probably benign Het
Vwa8 T A 14: 79,062,696 probably benign Het
Other mutations in 1700123L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:1700123L14Rik APN 6 96165694 missense possibly damaging 0.48
IGL02347:1700123L14Rik APN 6 96165530 missense probably damaging 1.00
IGL02532:1700123L14Rik APN 6 96164790 missense probably damaging 0.99
R0282:1700123L14Rik UTSW 6 96164816 missense probably benign 0.02
R0946:1700123L14Rik UTSW 6 96165696 missense possibly damaging 0.68
R1275:1700123L14Rik UTSW 6 96165118 missense probably benign 0.03
R1605:1700123L14Rik UTSW 6 96164812 missense probably benign 0.34
R1610:1700123L14Rik UTSW 6 96165289 missense probably damaging 0.98
R1959:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R1961:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R2116:1700123L14Rik UTSW 6 96164860 missense probably damaging 0.99
R4157:1700123L14Rik UTSW 6 96165283 missense possibly damaging 0.86
R4285:1700123L14Rik UTSW 6 96165752 missense probably benign 0.07
R4571:1700123L14Rik UTSW 6 96164881 missense probably damaging 1.00
R4884:1700123L14Rik UTSW 6 96164812 missense probably damaging 1.00
R4905:1700123L14Rik UTSW 6 96165930 missense possibly damaging 0.77
R6454:1700123L14Rik UTSW 6 96165628 missense possibly damaging 0.75
R6755:1700123L14Rik UTSW 6 96164972 missense probably benign 0.06
R6790:1700123L14Rik UTSW 6 96165323 missense probably benign
R6792:1700123L14Rik UTSW 6 96165115 missense possibly damaging 0.92
R6931:1700123L14Rik UTSW 6 96165548 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTGCAGTAACAGAACCCAAGG -3'
(R):5'- TGCTGACCACCAAATCTCTC -3'

Sequencing Primer
(F):5'- CTTGGGCTCTGCTGCAG -3'
(R):5'- TCTCTCCAGGCTCCCAATAGAG -3'
Posted On2015-01-23