Incidental Mutation 'R3708:Olfr584'
ID259442
Institutional Source Beutler Lab
Gene Symbol Olfr584
Ensembl Gene ENSMUSG00000073959
Gene Nameolfactory receptor 584
SynonymsGA_x6K02T2PBJ9-5796876-5797820, MOR30-2
MMRRC Submission 040701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3708 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103081885-103088315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103086294 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 254 (Y254D)
Ref Sequence ENSEMBL: ENSMUSP00000151043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098210] [ENSMUST00000211036] [ENSMUST00000214215]
Predicted Effect probably damaging
Transcript: ENSMUST00000098210
AA Change: Y259D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095811
Gene: ENSMUSG00000073959
AA Change: Y259D

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 1.4e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 234 2.1e-9 PFAM
Pfam:7tm_1 48 299 4.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211036
AA Change: Y254D
Predicted Effect probably damaging
Transcript: ENSMUST00000214215
AA Change: Y254D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.1%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
1700123L14Rik G A 6: 96,165,952 T37I possibly damaging Het
Abcc5 G T 16: 20,372,180 Q807K probably benign Het
Amfr T C 8: 93,983,320 H419R probably benign Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn7l3 G A 11: 102,291,879 probably benign Het
Bcs1l A G 1: 74,590,105 probably benign Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Celf2 C A 2: 6,624,678 K137N probably damaging Het
Cmya5 A T 13: 93,095,366 Y1071* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Cyp3a41a A G 5: 145,717,923 probably null Het
Dnah8 A T 17: 30,739,657 I2158L probably damaging Het
Dtnb T A 12: 3,589,156 probably null Het
Dync1h1 T C 12: 110,643,129 F2782L probably damaging Het
Ednrb A G 14: 103,817,080 Y439H probably damaging Het
Ferd3l T C 12: 33,928,749 V87A probably benign Het
Gphn T A 12: 78,532,693 S320T probably benign Het
Gpr39 C T 1: 125,872,612 H367Y probably damaging Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Lrba A G 3: 86,285,024 M82V possibly damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Map2 A T 1: 66,416,555 probably benign Het
Ncor1 T C 11: 62,344,687 K647R probably damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Obox7 C A 7: 14,664,197 S54* probably null Het
Olfr1016 T A 2: 85,799,998 I91L probably benign Het
Olfr135 A G 17: 38,208,283 I13V probably benign Het
Olfr888 T C 9: 38,109,444 S253P probably damaging Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pcdhb19 T A 18: 37,497,389 I79K probably benign Het
Pi4k2a C T 19: 42,090,931 Q144* probably null Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pnmal1 T A 7: 16,960,225 S2T probably damaging Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims3 A G 4: 120,883,155 T100A probably damaging Het
Serpinb9 A T 13: 33,008,019 N61I possibly damaging Het
Sis A G 3: 72,943,523 M614T probably benign Het
Slc6a17 C T 3: 107,493,085 V243I probably benign Het
Smad9 A T 3: 54,786,181 Y177F probably benign Het
Vmn2r69 T C 7: 85,411,821 D185G probably damaging Het
Vps36 G T 8: 22,192,883 V5L probably benign Het
Vwa8 T A 14: 79,062,696 probably benign Het
Other mutations in Olfr584
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Olfr584 APN 7 103086375 missense probably benign 0.00
IGL02113:Olfr584 APN 7 103085850 missense possibly damaging 0.95
IGL02398:Olfr584 APN 7 103086106 missense probably damaging 1.00
IGL02718:Olfr584 APN 7 103085583 missense probably benign 0.01
IGL02941:Olfr584 APN 7 103086321 missense probably benign 0.05
IGL02942:Olfr584 APN 7 103086198 missense probably benign 0.07
R0496:Olfr584 UTSW 7 103085590 missense probably damaging 1.00
R0511:Olfr584 UTSW 7 103085851 missense probably damaging 1.00
R0646:Olfr584 UTSW 7 103086151 missense probably damaging 0.99
R1652:Olfr584 UTSW 7 103085806 missense probably benign 0.04
R2312:Olfr584 UTSW 7 103086426 missense probably damaging 0.99
R2849:Olfr584 UTSW 7 103086112 missense probably damaging 1.00
R2937:Olfr584 UTSW 7 103086341 missense probably benign 0.01
R3176:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3276:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R4737:Olfr584 UTSW 7 103085914 missense probably damaging 1.00
R5045:Olfr584 UTSW 7 103086457 missense probably benign 0.00
R5172:Olfr584 UTSW 7 103085677 missense probably damaging 1.00
R5849:Olfr584 UTSW 7 103085521 start codon destroyed probably null 0.02
R6294:Olfr584 UTSW 7 103085667 missense probably benign 0.01
R6846:Olfr584 UTSW 7 103086058 missense possibly damaging 0.88
R6869:Olfr584 UTSW 7 103085868 missense possibly damaging 0.47
R6936:Olfr584 UTSW 7 103085814 missense probably damaging 0.97
R7133:Olfr584 UTSW 7 103085998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCTACTGTGAGCACATGG -3'
(R):5'- CTTTTACACAAAACCCTCGGG -3'

Sequencing Primer
(F):5'- TGCTGATACCAGAGTCAATCGTG -3'
(R):5'- GGTAACCCTGTCTCTGATCTG -3'
Posted On2015-01-23