Incidental Mutation 'R3708:Amfr'
ID 259444
Institutional Source Beutler Lab
Gene Symbol Amfr
Ensembl Gene ENSMUSG00000031751
Gene Name autocrine motility factor receptor
Synonyms gp78
MMRRC Submission 040701-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3708 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 94698216-94739301 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94709948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 419 (H419R)
Ref Sequence ENSEMBL: ENSMUSP00000052258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053766]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053766
AA Change: H419R

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052258
Gene: ENSMUSG00000031751
AA Change: H419R

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 141 158 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
RING 337 374 1.14e-8 SMART
CUE 452 493 3.3e-11 SMART
PDB:4LAD|B 571 596 2e-7 PDB
low complexity region 620 637 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.1%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice for a gene-trapped null allele are obese and develop liver steatosis and/or hepatic inflammation resembling nonalcoholic steatohepatitis. Some mice develop liver tumors. Mice homozygous for another knock-out allele exhibit normal HMGCR turnover in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Abcc5 G T 16: 20,190,930 (GRCm39) Q807K probably benign Het
Atp8b2 A T 3: 89,852,459 (GRCm39) F866I probably damaging Het
Atxn7l3 G A 11: 102,182,705 (GRCm39) probably benign Het
Bcs1l A G 1: 74,629,264 (GRCm39) probably benign Het
Card11 G A 5: 140,872,890 (GRCm39) R608C probably damaging Het
Celf2 C A 2: 6,629,489 (GRCm39) K137N probably damaging Het
Cmya5 A T 13: 93,231,874 (GRCm39) Y1071* probably null Het
Cyp2d10 A G 15: 82,287,217 (GRCm39) F469L possibly damaging Het
Cyp3a41a A G 5: 145,654,733 (GRCm39) probably null Het
Dnah8 A T 17: 30,958,631 (GRCm39) I2158L probably damaging Het
Dtnb T A 12: 3,639,156 (GRCm39) probably null Het
Dync1h1 T C 12: 110,609,563 (GRCm39) F2782L probably damaging Het
Ednrb A G 14: 104,054,516 (GRCm39) Y439H probably damaging Het
Ferd3l T C 12: 33,978,748 (GRCm39) V87A probably benign Het
Gphn T A 12: 78,579,467 (GRCm39) S320T probably benign Het
Gpr39 C T 1: 125,800,349 (GRCm39) H367Y probably damaging Het
Hspa4l A T 3: 40,736,125 (GRCm39) N582I possibly damaging Het
Ighv1-85 A T 12: 115,963,836 (GRCm39) W55R probably damaging Het
Lelp1 A C 3: 92,042,714 (GRCm39) C112G unknown Het
Lrba A G 3: 86,192,331 (GRCm39) M82V possibly damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Map2 A T 1: 66,455,714 (GRCm39) probably benign Het
Ncor1 T C 11: 62,235,513 (GRCm39) K647R probably damaging Het
Nr4a3 A T 4: 48,056,699 (GRCm39) Y417F probably damaging Het
Nup50l G A 6: 96,142,933 (GRCm39) T37I possibly damaging Het
Obox7 C A 7: 14,398,122 (GRCm39) S54* probably null Het
Or2n1c A G 17: 38,519,174 (GRCm39) I13V probably benign Het
Or52r1c T G 7: 102,735,501 (GRCm39) Y254D probably damaging Het
Or8b101 T C 9: 38,020,740 (GRCm39) S253P probably damaging Het
Or9g20 T A 2: 85,630,342 (GRCm39) I91L probably benign Het
Pappa2 A T 1: 158,662,488 (GRCm39) Y1162* probably null Het
Pcdhb19 T A 18: 37,630,442 (GRCm39) I79K probably benign Het
Pi4k2a C T 19: 42,079,370 (GRCm39) Q144* probably null Het
Pigc T A 1: 161,798,663 (GRCm39) M215K probably benign Het
Pnma8a T A 7: 16,694,150 (GRCm39) S2T probably damaging Het
Ppfia4 T C 1: 134,237,398 (GRCm39) E967G probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rims3 A G 4: 120,740,352 (GRCm39) T100A probably damaging Het
Serpinb9 A T 13: 33,192,002 (GRCm39) N61I possibly damaging Het
Sis A G 3: 72,850,856 (GRCm39) M614T probably benign Het
Slc6a17 C T 3: 107,400,401 (GRCm39) V243I probably benign Het
Smad9 A T 3: 54,693,602 (GRCm39) Y177F probably benign Het
Vmn2r69 T C 7: 85,061,029 (GRCm39) D185G probably damaging Het
Vps36 G T 8: 22,682,899 (GRCm39) V5L probably benign Het
Vwa8 T A 14: 79,300,136 (GRCm39) probably benign Het
Other mutations in Amfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Amfr APN 8 94,714,136 (GRCm39) critical splice acceptor site probably null
IGL02169:Amfr APN 8 94,731,858 (GRCm39) splice site probably null
IGL03218:Amfr APN 8 94,726,964 (GRCm39) missense probably damaging 0.97
FR4449:Amfr UTSW 8 94,731,787 (GRCm39) missense probably damaging 1.00
FR4737:Amfr UTSW 8 94,731,787 (GRCm39) missense probably damaging 1.00
FR4976:Amfr UTSW 8 94,738,920 (GRCm39) unclassified probably benign
R0344:Amfr UTSW 8 94,713,998 (GRCm39) splice site probably null
R0532:Amfr UTSW 8 94,725,736 (GRCm39) missense probably damaging 1.00
R1056:Amfr UTSW 8 94,712,097 (GRCm39) missense probably benign 0.27
R1295:Amfr UTSW 8 94,701,432 (GRCm39) missense probably benign 0.26
R1386:Amfr UTSW 8 94,712,027 (GRCm39) missense possibly damaging 0.58
R1450:Amfr UTSW 8 94,714,375 (GRCm39) missense probably benign 0.45
R1613:Amfr UTSW 8 94,725,854 (GRCm39) missense probably benign 0.00
R1703:Amfr UTSW 8 94,700,871 (GRCm39) missense probably benign
R2857:Amfr UTSW 8 94,731,842 (GRCm39) missense probably damaging 1.00
R2858:Amfr UTSW 8 94,731,842 (GRCm39) missense probably damaging 1.00
R2859:Amfr UTSW 8 94,731,842 (GRCm39) missense probably damaging 1.00
R3109:Amfr UTSW 8 94,726,934 (GRCm39) missense probably damaging 1.00
R4456:Amfr UTSW 8 94,711,568 (GRCm39) missense possibly damaging 0.80
R4600:Amfr UTSW 8 94,700,849 (GRCm39) missense probably damaging 0.99
R4952:Amfr UTSW 8 94,699,787 (GRCm39) unclassified probably benign
R5261:Amfr UTSW 8 94,702,798 (GRCm39) critical splice acceptor site probably null
R5391:Amfr UTSW 8 94,702,676 (GRCm39) missense probably damaging 1.00
R5788:Amfr UTSW 8 94,726,942 (GRCm39) missense probably damaging 1.00
R6238:Amfr UTSW 8 94,726,992 (GRCm39) missense probably damaging 1.00
R6584:Amfr UTSW 8 94,700,783 (GRCm39) missense probably benign 0.00
R6795:Amfr UTSW 8 94,726,961 (GRCm39) missense probably benign 0.09
R6955:Amfr UTSW 8 94,727,004 (GRCm39) missense probably damaging 1.00
R6978:Amfr UTSW 8 94,727,015 (GRCm39) missense probably damaging 0.99
R7097:Amfr UTSW 8 94,738,637 (GRCm39) missense probably benign 0.00
R7224:Amfr UTSW 8 94,711,484 (GRCm39) missense probably damaging 1.00
R7260:Amfr UTSW 8 94,702,776 (GRCm39) missense possibly damaging 0.80
R7289:Amfr UTSW 8 94,725,754 (GRCm39) missense possibly damaging 0.64
R8341:Amfr UTSW 8 94,725,806 (GRCm39) missense probably damaging 0.98
R8858:Amfr UTSW 8 94,714,070 (GRCm39) missense probably damaging 1.00
R9377:Amfr UTSW 8 94,707,018 (GRCm39) missense probably damaging 1.00
RF030:Amfr UTSW 8 94,738,920 (GRCm39) unclassified probably benign
RF035:Amfr UTSW 8 94,738,920 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGAACACTTCTGAAACTGAGGC -3'
(R):5'- TTGGCTAGAACAAGACACCTC -3'

Sequencing Primer
(F):5'- GTTCAAGGCCAGTCTGTGATACAC -3'
(R):5'- CTCTTGTCCAACATGCAGAATG -3'
Posted On 2015-01-23