Incidental Mutation 'R3710:Bud23'
ID259535
Institutional Source Beutler Lab
Gene Symbol Bud23
Ensembl Gene ENSMUSG00000005378
Gene NameBUD23, rRNA methyltransferase and ribosome maturation factor
Synonyms1110003N24Rik, Wbscr22
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3710 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135052957-135064959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 135056350 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 41 (S41A)
Ref Sequence ENSEMBL: ENSMUSP00000120383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000129691] [ENSMUST00000141309] [ENSMUST00000148549]
Predicted Effect probably benign
Transcript: ENSMUST00000071677
AA Change: S189A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378
AA Change: S189A

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085984
AA Change: S211A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378
AA Change: S211A

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111205
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129691
AA Change: S41A

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120383
Gene: ENSMUSG00000005378
AA Change: S41A

DomainStartEndE-ValueType
Pfam:WBS_methylT 88 138 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134180
Predicted Effect probably benign
Transcript: ENSMUST00000141309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147756
Predicted Effect probably benign
Transcript: ENSMUST00000148549
SMART Domains Protein: ENSMUSP00000118370
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:Methyltransf_23 3 89 1.4e-8 PFAM
Pfam:Methyltransf_11 27 93 5.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157383
Predicted Effect probably benign
Transcript: ENSMUST00000202478
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Bud23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Bud23 APN 5 135061081 missense probably damaging 0.99
IGL03281:Bud23 APN 5 135063887 missense probably benign 0.01
R1103:Bud23 UTSW 5 135061139 missense probably damaging 1.00
R1765:Bud23 UTSW 5 135056043 missense probably benign 0.00
R4486:Bud23 UTSW 5 135063925 unclassified probably null
R5109:Bud23 UTSW 5 135061023 intron probably benign
R5550:Bud23 UTSW 5 135063890 missense probably benign
R5614:Bud23 UTSW 5 135059112 missense probably benign 0.00
R5822:Bud23 UTSW 5 135063921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGCATCCAGGTCTGAGTAAG -3'
(R):5'- GGACGAAGAGCTGTCTCCATAG -3'

Sequencing Primer
(F):5'- CAGGTCTGAGTAAGCCCCATAG -3'
(R):5'- AGCTGTCTCCATAGCTCTGGG -3'
Posted On2015-01-23