Incidental Mutation 'R3710:Tgm1'
ID259562
Institutional Source Beutler Lab
Gene Symbol Tgm1
Ensembl Gene ENSMUSG00000022218
Gene Nametransglutaminase 1, K polypeptide
SynonymsTG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R3710 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55700009-55713926 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 55712595 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000168729] [ENSMUST00000169237] [ENSMUST00000178034] [ENSMUST00000226907] [ENSMUST00000227061] [ENSMUST00000227958] [ENSMUST00000228123]
Predicted Effect unknown
Transcript: ENSMUST00000002389
AA Change: G52V
SMART Domains Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218
AA Change: G52V

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062861
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168729
AA Change: G52V
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218
AA Change: G52V

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169237
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178034
AA Change: G52V
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218
AA Change: G52V

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226209
Predicted Effect unknown
Transcript: ENSMUST00000226907
AA Change: G52V
Predicted Effect probably benign
Transcript: ENSMUST00000227061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect unknown
Transcript: ENSMUST00000227958
AA Change: G52V
Predicted Effect unknown
Transcript: ENSMUST00000228123
AA Change: G52V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228899
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Tgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Tgm1 APN 14 55704935 missense possibly damaging 0.92
IGL02934:Tgm1 APN 14 55709989 missense probably damaging 1.00
IGL03243:Tgm1 APN 14 55705907 missense probably damaging 0.98
IGL03282:Tgm1 APN 14 55711070 missense probably damaging 1.00
PIT4458001:Tgm1 UTSW 14 55712565 missense unknown
R0277:Tgm1 UTSW 14 55710927 unclassified probably benign
R0277:Tgm1 UTSW 14 55712652 unclassified probably benign
R0478:Tgm1 UTSW 14 55700334 nonsense probably null
R1349:Tgm1 UTSW 14 55711201 unclassified probably benign
R1594:Tgm1 UTSW 14 55709519 missense probably damaging 0.96
R1776:Tgm1 UTSW 14 55709397 missense probably damaging 0.99
R1852:Tgm1 UTSW 14 55704941 missense probably damaging 1.00
R1988:Tgm1 UTSW 14 55705577 missense probably benign 0.00
R2064:Tgm1 UTSW 14 55709471 missense probably damaging 1.00
R2139:Tgm1 UTSW 14 55709543 missense probably damaging 1.00
R2427:Tgm1 UTSW 14 55712100 critical splice donor site probably null
R3917:Tgm1 UTSW 14 55712757 splice site probably benign
R4697:Tgm1 UTSW 14 55705681 missense probably benign 0.05
R4804:Tgm1 UTSW 14 55705619 missense probably benign 0.38
R5074:Tgm1 UTSW 14 55709935 missense probably damaging 1.00
R5341:Tgm1 UTSW 14 55700248 missense possibly damaging 0.90
R5346:Tgm1 UTSW 14 55711172 missense probably damaging 0.99
R5557:Tgm1 UTSW 14 55705643 missense probably benign 0.10
R5566:Tgm1 UTSW 14 55712436 missense probably damaging 0.99
R5828:Tgm1 UTSW 14 55705554 missense probably benign 0.38
R6802:Tgm1 UTSW 14 55712482 unclassified probably benign
R7017:Tgm1 UTSW 14 55704941 missense possibly damaging 0.76
R7094:Tgm1 UTSW 14 55704843 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGTTCCATAAAGGCTCAGCTC -3'
(R):5'- GAGTGAATGAGCACCCTCTG -3'

Sequencing Primer
(F):5'- CCATAAAGGCTCAGCTCTAGGTTAAG -3'
(R):5'- GTCTCTTCTACACAGGCACAATGG -3'
Posted On2015-01-23