Incidental Mutation 'R3710:Col2a1'
ID259567
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Namecollagen, type II, alpha 1
SynonymsM100856, Col2a, Col2a-1, Del1, Col2, Rgsc856, Lpk
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3710 (G1)
Quality Score189
Status Validated
Chromosome15
Chromosomal Location97975602-98004695 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 97990907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355] [ENSMUST00000131560]
Predicted Effect probably benign
Transcript: ENSMUST00000023123
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088355
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131560
SMART Domains Protein: ENSMUSP00000116951
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
low complexity region 109 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139246
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps17 T A 7: 81,344,924 T30S probably benign Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97976173 missense unknown
IGL01286:Col2a1 APN 15 97994878 missense unknown
IGL01369:Col2a1 APN 15 97977826 missense unknown
IGL01747:Col2a1 APN 15 97991392 splice site probably benign
IGL02086:Col2a1 APN 15 97986737 splice site probably null
IGL02549:Col2a1 APN 15 97977799 missense unknown
IGL03289:Col2a1 APN 15 97980881 missense unknown
IGL03369:Col2a1 APN 15 97982042 missense unknown
FR4304:Col2a1 UTSW 15 97988981 synonymous probably null
FR4340:Col2a1 UTSW 15 97988981 synonymous probably null
FR4342:Col2a1 UTSW 15 97988981 synonymous probably null
FR4589:Col2a1 UTSW 15 97988981 synonymous probably null
LCD18:Col2a1 UTSW 15 97988981 synonymous probably null
R0124:Col2a1 UTSW 15 97998862 missense unknown
R0227:Col2a1 UTSW 15 97976755 missense unknown
R0690:Col2a1 UTSW 15 97980192 missense unknown
R1434:Col2a1 UTSW 15 97979651 missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97982908 splice site probably benign
R1577:Col2a1 UTSW 15 97979202 missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97979250 missense probably damaging 0.99
R1837:Col2a1 UTSW 15 97996641 splice site probably benign
R2153:Col2a1 UTSW 15 97987580 missense unknown
R2965:Col2a1 UTSW 15 97976095 missense unknown
R2966:Col2a1 UTSW 15 97976095 missense unknown
R3838:Col2a1 UTSW 15 97988976 missense unknown
R3838:Col2a1 UTSW 15 98000581 intron probably benign
R4112:Col2a1 UTSW 15 97983701 missense probably benign 0.18
R4417:Col2a1 UTSW 15 97998585 missense unknown
R4656:Col2a1 UTSW 15 97976176 missense unknown
R4960:Col2a1 UTSW 15 97976149 missense unknown
R5008:Col2a1 UTSW 15 97979669 missense probably benign 0.28
R5435:Col2a1 UTSW 15 98000510 intron probably benign
R5473:Col2a1 UTSW 15 97987489 missense unknown
R6042:Col2a1 UTSW 15 98000570 intron probably benign
R6118:Col2a1 UTSW 15 97998567 missense unknown
R6183:Col2a1 UTSW 15 97988790 missense unknown
R6187:Col2a1 UTSW 15 97988790 missense unknown
R6401:Col2a1 UTSW 15 97985892 missense unknown
R6550:Col2a1 UTSW 15 97976793 missense unknown
R6568:Col2a1 UTSW 15 97977276 missense unknown
R6988:Col2a1 UTSW 15 98004454 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGGTGGACTTCAGCCTCTAC -3'
(R):5'- GGCTTCTCACAGACTCAGAAAC -3'

Sequencing Primer
(F):5'- TGGACTTCAGCCTCTACAACCG -3'
(R):5'- CAAGAGGAGCAGGGTGTCTCTC -3'
Posted On2015-01-23