Incidental Mutation 'R3712:Alx4'
ID259645
Institutional Source Beutler Lab
Gene Symbol Alx4
Ensembl Gene ENSMUSG00000040310
Gene Namearistaless-like homeobox 4
SynonymsAristaless-like 4
MMRRC Submission 040705-MU
Accession Numbers

Genbank: NM_007442; MGI: 108359

Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R3712 (G1)
Quality Score165
Status Validated
Chromosome2
Chromosomal Location93642384-93681339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93642789 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 44 (G44D)
Ref Sequence ENSEMBL: ENSMUSP00000047962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042078] [ENSMUST00000111254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042078
AA Change: G44D

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047962
Gene: ENSMUSG00000040310
AA Change: G44D

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
low complexity region 302 319 N/A INTRINSIC
Pfam:OAR 375 393 1.5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111254
AA Change: G44D

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106885
Gene: ENSMUSG00000040310
AA Change: G44D

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]
PHENOTYPE: Depending on genetic background mutant mice may show preaxial polydactyly and other skeletal alterations, transitory alopecia, ventral body wall defects and male sterility. Homozygous mice of one allele die prenatally. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,627,523 V27F unknown Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Arhgap31 T A 16: 38,602,533 E1057V possibly damaging Het
Arhgef26 A T 3: 62,423,629 D588V probably damaging Het
Bag2 T A 1: 33,746,916 E108D probably benign Het
Ccdc162 C T 10: 41,587,379 V183I probably benign Het
Ccdc58 T C 16: 36,081,405 probably null Het
Ccdc83 A G 7: 90,236,355 probably benign Het
Ccnyl1 G A 1: 64,714,668 E137K probably damaging Het
Celsr2 T C 3: 108,400,839 T1849A probably benign Het
Cep192 C A 18: 67,820,329 D472E probably benign Het
Cep57l1 A G 10: 41,743,114 Y86H probably damaging Het
Cep95 G T 11: 106,811,286 E370* probably null Het
Cldn10 A G 14: 118,855,110 T41A probably damaging Het
Clptm1l T A 13: 73,616,038 Y426N probably benign Het
Eps15 T C 4: 109,309,177 V89A probably damaging Het
Fam53b A G 7: 132,759,925 S125P probably damaging Het
Fam69b T C 2: 26,632,638 L33S possibly damaging Het
Fbxo44 A T 4: 148,156,004 W256R probably benign Het
Gnl2 T C 4: 125,046,274 V313A probably damaging Het
Hyal4 A G 6: 24,756,514 R244G probably damaging Het
Irf6 G T 1: 193,162,623 W134L probably benign Het
Kcnu1 A G 8: 25,881,420 T286A probably damaging Het
Lpcat2 T C 8: 92,918,170 V529A possibly damaging Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp8 G T 4: 107,848,302 R209L probably benign Het
Mgll T C 6: 88,764,588 probably benign Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr411 A T 11: 74,347,197 I129N probably damaging Het
Olfr490 A T 7: 108,286,456 Y223* probably null Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Orc1 T C 4: 108,604,021 V526A probably damaging Het
Pard3b T C 1: 62,343,978 S744P probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pdcd11 T A 19: 47,127,245 probably benign Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Pigt A G 2: 164,501,645 D347G probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Rpl7a-ps10 A G 9: 97,179,873 E232G probably damaging Het
Rprd2 A G 3: 95,764,560 L1177P probably damaging Het
Rrn3 T A 16: 13,784,095 L71* probably null Het
Sbspon A G 1: 15,892,445 C70R probably damaging Het
Smtn A T 11: 3,532,865 probably null Het
Son A G 16: 91,656,726 D787G probably damaging Het
Sphkap C T 1: 83,277,112 S972N probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Srp14 A C 2: 118,478,959 L58V probably null Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trdn T C 10: 33,157,166 I129T probably benign Het
Trpv3 A G 11: 73,278,954 K117R probably benign Het
Ubqlnl A T 7: 104,149,138 I384N probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r59 A T 7: 5,454,638 I41K probably damaging Het
Vmn2r125 T A 4: 156,350,124 Y68* probably null Het
Zpld1 A T 16: 55,226,436 L390* probably null Het
Other mutations in Alx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Alx4 APN 2 93677473 missense probably benign 0.10
goofy UTSW 2 93675369 missense probably damaging 1.00
R0367:Alx4 UTSW 2 93668608 missense probably damaging 1.00
R0436:Alx4 UTSW 2 93668357 nonsense probably null
R0864:Alx4 UTSW 2 93642855 missense probably damaging 1.00
R1913:Alx4 UTSW 2 93675387 missense probably damaging 1.00
R4619:Alx4 UTSW 2 93642761 missense probably damaging 1.00
R5018:Alx4 UTSW 2 93677419 missense probably damaging 0.99
R5227:Alx4 UTSW 2 93677380 missense probably damaging 1.00
R6505:Alx4 UTSW 2 93668559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTTCTCAAGGCCAGCTG -3'
(R):5'- TCTGCAAGTAGAGATGCGC -3'

Sequencing Primer
(F):5'- TTCTCAAGGCCAGCTGTAGGG -3'
(R):5'- TAGAGATGCGCAGGCGGC -3'
Posted On2015-01-23