Incidental Mutation 'R3712:Trpv3'
ID259676
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission 040705-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3712 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73278954 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 117 (K117R)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure
Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049676
AA Change: K117R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: K117R

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,627,523 V27F unknown Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Alx4 G A 2: 93,642,789 G44D possibly damaging Het
Arhgap31 T A 16: 38,602,533 E1057V possibly damaging Het
Arhgef26 A T 3: 62,423,629 D588V probably damaging Het
Bag2 T A 1: 33,746,916 E108D probably benign Het
Ccdc162 C T 10: 41,587,379 V183I probably benign Het
Ccdc58 T C 16: 36,081,405 probably null Het
Ccdc83 A G 7: 90,236,355 probably benign Het
Ccnyl1 G A 1: 64,714,668 E137K probably damaging Het
Celsr2 T C 3: 108,400,839 T1849A probably benign Het
Cep192 C A 18: 67,820,329 D472E probably benign Het
Cep57l1 A G 10: 41,743,114 Y86H probably damaging Het
Cep95 G T 11: 106,811,286 E370* probably null Het
Cldn10 A G 14: 118,855,110 T41A probably damaging Het
Clptm1l T A 13: 73,616,038 Y426N probably benign Het
Eps15 T C 4: 109,309,177 V89A probably damaging Het
Fam53b A G 7: 132,759,925 S125P probably damaging Het
Fam69b T C 2: 26,632,638 L33S possibly damaging Het
Fbxo44 A T 4: 148,156,004 W256R probably benign Het
Gnl2 T C 4: 125,046,274 V313A probably damaging Het
Hyal4 A G 6: 24,756,514 R244G probably damaging Het
Irf6 G T 1: 193,162,623 W134L probably benign Het
Kcnu1 A G 8: 25,881,420 T286A probably damaging Het
Lpcat2 T C 8: 92,918,170 V529A possibly damaging Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp8 G T 4: 107,848,302 R209L probably benign Het
Mgll T C 6: 88,764,588 probably benign Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr411 A T 11: 74,347,197 I129N probably damaging Het
Olfr490 A T 7: 108,286,456 Y223* probably null Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Orc1 T C 4: 108,604,021 V526A probably damaging Het
Pard3b T C 1: 62,343,978 S744P probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pdcd11 T A 19: 47,127,245 probably benign Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Pigt A G 2: 164,501,645 D347G probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Rpl7a-ps10 A G 9: 97,179,873 E232G probably damaging Het
Rprd2 A G 3: 95,764,560 L1177P probably damaging Het
Rrn3 T A 16: 13,784,095 L71* probably null Het
Sbspon A G 1: 15,892,445 C70R probably damaging Het
Smtn A T 11: 3,532,865 probably null Het
Son A G 16: 91,656,726 D787G probably damaging Het
Sphkap C T 1: 83,277,112 S972N probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Srp14 A C 2: 118,478,959 L58V probably null Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trdn T C 10: 33,157,166 I129T probably benign Het
Ubqlnl A T 7: 104,149,138 I384N probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r59 A T 7: 5,454,638 I41K probably damaging Het
Vmn2r125 T A 4: 156,350,124 Y68* probably null Het
Zpld1 A T 16: 55,226,436 L390* probably null Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACAAACATGGGCATCGG -3'
(R):5'- ATCCAAGGTGCCTCATGCTC -3'

Sequencing Primer
(F):5'- CAAACATGGGCATCGGCAAAG -3'
(R):5'- GAGCAGGGTTCAAGCCAACC -3'
Posted On2015-01-23