Incidental Mutation 'R3713:Cecr2'
ID259731
Institutional Source Beutler Lab
Gene Symbol Cecr2
Ensembl Gene ENSMUSG00000071226
Gene NameCECR2, histone acetyl-lysine reader
SynonymsGtl4, 2610101O16Rik, 2810409N01Rik
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3713 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120666369-120771190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120758260 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 819 (L819P)
Ref Sequence ENSEMBL: ENSMUSP00000098556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]
Predicted Effect probably damaging
Transcript: ENSMUST00000100993
AA Change: L819P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: L819P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:WHIM3 244 284 5.2e-11 PFAM
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 781 796 N/A INTRINSIC
low complexity region 839 855 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
low complexity region 1202 1223 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112686
AA Change: L791P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: L791P

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 862 879 N/A INTRINSIC
low complexity region 1145 1159 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124634
Predicted Effect probably benign
Transcript: ENSMUST00000129803
SMART Domains Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
coiled coil region 90 150 N/A INTRINSIC
Pfam:Bromodomain 191 234 1.1e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143563
AA Change: L42P
SMART Domains Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226
AA Change: L42P

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 114 131 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Rangap1 C A 15: 81,710,460 E389D probably benign Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Cecr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cecr2 APN 6 120756717 missense probably damaging 1.00
IGL00782:Cecr2 APN 6 120761621 missense probably benign 0.00
IGL01137:Cecr2 APN 6 120762028 missense probably damaging 1.00
IGL01446:Cecr2 APN 6 120758599 missense probably benign
IGL02108:Cecr2 APN 6 120762558 critical splice donor site probably null
IGL02195:Cecr2 APN 6 120731406 missense probably damaging 1.00
IGL02689:Cecr2 APN 6 120762167 missense probably damaging 1.00
IGL03189:Cecr2 APN 6 120762430 missense probably benign 0.13
PIT1430001:Cecr2 UTSW 6 120758479 missense probably benign 0.01
R0200:Cecr2 UTSW 6 120761797 missense probably damaging 1.00
R0586:Cecr2 UTSW 6 120757884 missense probably damaging 1.00
R0715:Cecr2 UTSW 6 120758198 missense probably benign 0.21
R0784:Cecr2 UTSW 6 120758149 missense possibly damaging 0.74
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1343:Cecr2 UTSW 6 120754711 missense probably damaging 0.99
R1349:Cecr2 UTSW 6 120757603 missense probably damaging 0.99
R1386:Cecr2 UTSW 6 120762131 missense probably damaging 1.00
R1438:Cecr2 UTSW 6 120761472 nonsense probably null
R1602:Cecr2 UTSW 6 120755587 missense possibly damaging 0.52
R1664:Cecr2 UTSW 6 120762026 missense probably damaging 0.96
R1731:Cecr2 UTSW 6 120758180 missense possibly damaging 0.74
R1817:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1818:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1819:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1862:Cecr2 UTSW 6 120757941 missense probably damaging 1.00
R1907:Cecr2 UTSW 6 120761160 missense probably benign 0.03
R1911:Cecr2 UTSW 6 120762565 unclassified probably benign
R2135:Cecr2 UTSW 6 120720962 missense probably damaging 1.00
R2273:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R2275:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R4271:Cecr2 UTSW 6 120762475 missense probably damaging 1.00
R4706:Cecr2 UTSW 6 120755578 missense possibly damaging 0.73
R4873:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R4875:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R5137:Cecr2 UTSW 6 120755517 missense probably benign
R5153:Cecr2 UTSW 6 120734560 missense probably benign 0.03
R5377:Cecr2 UTSW 6 120756569 missense possibly damaging 0.87
R5598:Cecr2 UTSW 6 120731446 splice site probably null
R5651:Cecr2 UTSW 6 120755560 missense probably damaging 0.96
R5680:Cecr2 UTSW 6 120761426 missense probably benign
R5813:Cecr2 UTSW 6 120762208 missense probably damaging 0.99
R5970:Cecr2 UTSW 6 120720907 missense probably damaging 0.98
R6255:Cecr2 UTSW 6 120758050 missense probably damaging 1.00
R6266:Cecr2 UTSW 6 120761686 missense probably benign
R6630:Cecr2 UTSW 6 120762178 missense probably damaging 1.00
R6737:Cecr2 UTSW 6 120737123 missense possibly damaging 0.86
R6754:Cecr2 UTSW 6 120757578 missense probably damaging 0.98
R6807:Cecr2 UTSW 6 120734542 intron probably null
R7187:Cecr2 UTSW 6 120756686 missense probably benign
R7256:Cecr2 UTSW 6 120762529 missense probably benign
R7282:Cecr2 UTSW 6 120761621 missense
R7548:Cecr2 UTSW 6 120761714 missense
X0012:Cecr2 UTSW 6 120733774 missense probably damaging 0.99
X0063:Cecr2 UTSW 6 120762071 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTCTGAAATTCCTCCCGG -3'
(R):5'- TCATTTCAGGGCTGTCCATC -3'

Sequencing Primer
(F):5'- CACACCCTGCTGTTTGGAATGG -3'
(R):5'- ATCATGGATTCCCCTCCTTGTG -3'
Posted On2015-01-23