Incidental Mutation 'R3716:Btbd11'
ID259919
Institutional Source Beutler Lab
Gene Symbol Btbd11
Ensembl Gene ENSMUSG00000020042
Gene NameBTB (POZ) domain containing 11
Synonyms6330404E16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R3716 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85386814-85660292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85561528 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 442 (H442Y)
Ref Sequence ENSEMBL: ENSMUSP00000020231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020231] [ENSMUST00000105307]
Predicted Effect probably damaging
Transcript: ENSMUST00000020231
AA Change: H442Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020231
Gene: ENSMUSG00000020042
AA Change: H442Y

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
Blast:H2B 122 173 3e-9 BLAST
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 6e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 9e-16 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105307
AA Change: H442Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100944
Gene: ENSMUSG00000020042
AA Change: H442Y

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 5e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 1e-15 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
ANK 692 721 1.05e-3 SMART
ANK 735 765 2.21e3 SMART
BTB 928 1027 5.38e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Caps2 A G 10: 112,200,732 H399R probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Inpp5f C G 7: 128,690,670 L17V probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nelfcd T C 2: 174,423,005 V179A possibly damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Slc9c1 A T 16: 45,580,219 M731L probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Btbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Btbd11 APN 10 85629216 missense possibly damaging 0.87
IGL01143:Btbd11 APN 10 85654471 splice site probably benign
IGL01365:Btbd11 APN 10 85633816 missense possibly damaging 0.75
IGL01409:Btbd11 APN 10 85658165 missense possibly damaging 0.88
IGL01531:Btbd11 APN 10 85629205 splice site probably benign
IGL01593:Btbd11 APN 10 85654475 splice site probably benign
IGL01751:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL01752:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL02041:Btbd11 APN 10 85387554 missense unknown
IGL02486:Btbd11 APN 10 85640555 missense probably damaging 1.00
IGL02597:Btbd11 APN 10 85633801 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85633837 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85631286 splice site probably benign
IGL02967:Btbd11 APN 10 85633782 missense probably benign 0.11
IGL02975:Btbd11 APN 10 85631343 missense probably benign 0.16
IGL03078:Btbd11 APN 10 85632163 missense probably damaging 1.00
IGL03130:Btbd11 APN 10 85388483 splice site probably null
IGL03335:Btbd11 APN 10 85658358 utr 3 prime probably benign
R0024:Btbd11 UTSW 10 85387447 missense unknown
R0599:Btbd11 UTSW 10 85658336 missense probably damaging 1.00
R0655:Btbd11 UTSW 10 85645526 missense probably damaging 1.00
R0660:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R0664:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R1155:Btbd11 UTSW 10 85629291 missense probably damaging 1.00
R1244:Btbd11 UTSW 10 85387363 missense unknown
R1389:Btbd11 UTSW 10 85640596 missense possibly damaging 0.76
R1418:Btbd11 UTSW 10 85645578 missense probably damaging 1.00
R1703:Btbd11 UTSW 10 85387384 missense unknown
R1957:Btbd11 UTSW 10 85633699 missense probably damaging 1.00
R2519:Btbd11 UTSW 10 85651611 missense probably damaging 1.00
R3915:Btbd11 UTSW 10 85632270 missense probably damaging 1.00
R4738:Btbd11 UTSW 10 85627248 nonsense probably null
R4782:Btbd11 UTSW 10 85654550 missense probably damaging 1.00
R4846:Btbd11 UTSW 10 85629266 missense probably damaging 1.00
R4887:Btbd11 UTSW 10 85387378 missense unknown
R4960:Btbd11 UTSW 10 85651662 missense probably benign 0.34
R5224:Btbd11 UTSW 10 85645522 small deletion probably benign
R5341:Btbd11 UTSW 10 85387372 missense unknown
R5713:Btbd11 UTSW 10 85651652 missense probably damaging 1.00
R6046:Btbd11 UTSW 10 85388083 missense unknown
R6461:Btbd11 UTSW 10 85640564 missense probably damaging 1.00
R6809:Btbd11 UTSW 10 85631376 missense probably benign 0.01
R7069:Btbd11 UTSW 10 85387656 missense unknown
R7130:Btbd11 UTSW 10 85387555 missense unknown
R7202:Btbd11 UTSW 10 85387765 missense unknown
R7275:Btbd11 UTSW 10 85654482 missense probably damaging 1.00
X0020:Btbd11 UTSW 10 85631352 missense possibly damaging 0.86
Z1088:Btbd11 UTSW 10 85387857 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCCATCAGTGCTTCAGATC -3'
(R):5'- TTCTGTGATGCTCGGAAGTC -3'

Sequencing Primer
(F):5'- AGTGCTTCAGATCATCCCTGACAG -3'
(R):5'- GTCAGGCAAGACGTACCTTTC -3'
Posted On2015-01-23