Incidental Mutation 'R3716:Caps2'
ID259921
Institutional Source Beutler Lab
Gene Symbol Caps2
Ensembl Gene ENSMUSG00000035694
Gene Namecalcyphosphine 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3716 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112163621-112216555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112200732 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 399 (H399R)
Ref Sequence ENSEMBL: ENSMUSP00000129887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092176] [ENSMUST00000170013]
Predicted Effect probably benign
Transcript: ENSMUST00000092176
AA Change: H357R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089815
Gene: ENSMUSG00000035694
AA Change: H357R

DomainStartEndE-ValueType
Pfam:EF-hand_6 384 420 2e-4 PFAM
Blast:EFh 457 485 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132994
Predicted Effect probably benign
Transcript: ENSMUST00000170013
AA Change: H399R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129887
Gene: ENSMUSG00000035694
AA Change: H399R

DomainStartEndE-ValueType
PDB:3E3R|B 403 592 4e-27 PDB
Blast:EFh 425 453 1e-7 BLAST
SCOP:d1hqva_ 430 522 4e-10 SMART
Blast:EFh 461 491 3e-6 BLAST
Blast:EFh 499 527 6e-11 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcyphosine-2 is a calcium-binding protein with 2 EF-hand motifs (Wang et al., 2002 [PubMed 11846421]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Btbd11 C T 10: 85,561,528 H442Y probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Inpp5f C G 7: 128,690,670 L17V probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nelfcd T C 2: 174,423,005 V179A possibly damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Slc9c1 A T 16: 45,580,219 M731L probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Caps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Caps2 APN 10 112183060 missense probably damaging 1.00
IGL02159:Caps2 APN 10 112204023 missense probably benign 0.25
IGL02412:Caps2 APN 10 112204036 critical splice donor site probably null
IGL03380:Caps2 APN 10 112200696 missense probably benign 0.05
R0601:Caps2 UTSW 10 112195790 missense possibly damaging 0.95
R0658:Caps2 UTSW 10 112204038 splice site probably benign
R0846:Caps2 UTSW 10 112215585 missense probably damaging 1.00
R1472:Caps2 UTSW 10 112179472 missense probably benign 0.26
R1711:Caps2 UTSW 10 112190978 missense possibly damaging 0.86
R1834:Caps2 UTSW 10 112195718 missense possibly damaging 0.89
R1990:Caps2 UTSW 10 112200686 missense probably benign 0.01
R1996:Caps2 UTSW 10 112204003 missense probably damaging 1.00
R2077:Caps2 UTSW 10 112199727 missense possibly damaging 0.71
R3161:Caps2 UTSW 10 112182486 nonsense probably null
R3162:Caps2 UTSW 10 112182486 nonsense probably null
R3162:Caps2 UTSW 10 112182486 nonsense probably null
R4702:Caps2 UTSW 10 112208347 missense probably damaging 1.00
R4978:Caps2 UTSW 10 112182494 missense probably benign 0.04
R5285:Caps2 UTSW 10 112208311 missense probably benign
R5911:Caps2 UTSW 10 112165686 start gained probably benign
R5933:Caps2 UTSW 10 112215446 missense probably benign 0.38
R6368:Caps2 UTSW 10 112194968 nonsense probably null
R6476:Caps2 UTSW 10 112175560 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCTCCAGGGAATCAAAAGCAAT -3'
(R):5'- GGGATTTATCAGTGATTCAACATTCAC -3'

Sequencing Primer
(F):5'- ATGGGCAGAAGTGGGGCTTTC -3'
(R):5'- GAGGGGTCCTACCATTTATGACAAC -3'
Posted On2015-01-23