Incidental Mutation 'R3717:Olfr1495'
ID259979
Institutional Source Beutler Lab
Gene Symbol Olfr1495
Ensembl Gene ENSMUSG00000047207
Gene Nameolfactory receptor 1495
SynonymsGA_x6K02T2RE5P-4101369-4102328, MOR266-9
MMRRC Submission 040709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3717 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13764606-13770248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13769064 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 241 (R241G)
Ref Sequence ENSEMBL: ENSMUSP00000150205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061669] [ENSMUST00000215930] [ENSMUST00000216980]
Predicted Effect probably damaging
Transcript: ENSMUST00000061669
AA Change: R241G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057468
Gene: ENSMUSG00000047207
AA Change: R241G

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.4e-52 PFAM
Pfam:7tm_1 45 295 1.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215930
AA Change: R241G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216980
AA Change: R241G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,731,774 W245* probably null Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bpifb6 A G 2: 153,908,141 probably benign Het
Cmtr2 T C 8: 110,221,754 V232A probably damaging Het
Cmya5 A T 13: 93,092,487 M2031K probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Fgfr2 G A 7: 130,182,757 T270M probably damaging Het
Hoxd10 C T 2: 74,694,130 T262I probably damaging Het
Htt G A 5: 34,811,522 probably benign Het
Kbtbd3 A T 9: 4,330,598 H324L probably benign Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nxpe5 T C 5: 138,251,624 S559P probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr826 T A 10: 130,180,500 I127F possibly damaging Het
Ptx3 G T 3: 66,224,955 S299I probably benign Het
Rbbp4 T A 4: 129,328,632 D89V probably benign Het
Rfx4 A G 10: 84,880,224 E375G probably damaging Het
Senp7 T A 16: 56,179,057 probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Skiv2l2 A G 13: 112,895,595 F561S probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spata18 A T 5: 73,666,850 probably null Het
St8sia6 T C 2: 13,656,934 N362S possibly damaging Het
Tmub2 G T 11: 102,285,061 probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ttn T C 2: 76,944,710 D1996G possibly damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vdac1 A G 11: 52,376,646 probably null Het
Vps51 G A 19: 6,077,168 probably benign Het
Zfp90 A G 8: 106,424,050 R132G probably benign Het
Other mutations in Olfr1495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Olfr1495 APN 19 13768537 missense probably damaging 1.00
IGL01869:Olfr1495 APN 19 13769170 missense probably benign 0.02
IGL02088:Olfr1495 APN 19 13768666 missense probably damaging 1.00
R1583:Olfr1495 UTSW 19 13768510 missense probably benign 0.10
R1713:Olfr1495 UTSW 19 13769295 missense probably benign 0.00
R1859:Olfr1495 UTSW 19 13768724 nonsense probably null
R3718:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3881:Olfr1495 UTSW 19 13768780 missense probably benign
R4370:Olfr1495 UTSW 19 13768951 missense probably benign 0.02
R4873:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R4875:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R6335:Olfr1495 UTSW 19 13768780 missense probably benign
R6352:Olfr1495 UTSW 19 13768464 missense probably benign
Z1088:Olfr1495 UTSW 19 13768416 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATGTGGCTCCTATTATGCGC -3'
(R):5'- TAGTGTCAGAAGCTGGTACATGG -3'

Sequencing Primer
(F):5'- ATTATGCGCCTGGCCTG -3'
(R):5'- CTGGTACATGGAAGAAAGAGTTCCTC -3'
Posted On2015-01-23