Incidental Mutation 'R2888:Atp8b2'
ID259984
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
SynonymsId
MMRRC Submission 040476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2888 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89958293 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 100 (D100G)
Ref Sequence ENSEMBL: ENSMUSP00000128726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000168276] [ENSMUST00000168880] [ENSMUST00000170696] [ENSMUST00000171422]
Predicted Effect probably damaging
Transcript: ENSMUST00000069805
AA Change: D119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: D119G

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107396
AA Change: D100G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: D100G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166705
Predicted Effect probably damaging
Transcript: ENSMUST00000168276
AA Change: D100G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: D100G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168880
AA Change: D100G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128726
Gene: ENSMUSG00000060671
AA Change: D100G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170696
SMART Domains Protein: ENSMUSP00000126142
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 128 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171422
SMART Domains Protein: ENSMUSP00000129641
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
Acd A G 8: 105,698,838 S288P probably benign Het
Aimp2 T C 5: 143,909,735 probably benign Het
Cacna1i A T 15: 80,374,767 I1226F probably damaging Het
Dsp C A 13: 38,192,248 N1336K possibly damaging Het
Extl2 T C 3: 116,027,257 F251S probably damaging Het
Gm13089 G T 4: 143,696,890 T443K probably benign Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Itpr2 C T 6: 146,171,293 G2380S probably damaging Het
Kansl1l T C 1: 66,724,605 K762E probably benign Het
Krtap4-9 C A 11: 99,785,419 C55* probably null Het
Lamp1 T A 8: 13,173,891 L341H probably damaging Het
Llcfc1 A T 6: 41,684,603 K29M probably damaging Het
Malrd1 A T 2: 16,074,757 I1762F unknown Het
Muc5b G A 7: 141,861,554 V2746M probably damaging Het
Mug1 T A 6: 121,881,843 D1173E probably benign Het
Myo5b G C 18: 74,762,618 E1782Q probably damaging Het
Olfr325 T C 11: 58,581,162 F106S possibly damaging Het
Pcdha5 A G 18: 36,961,887 D483G probably damaging Het
Phex T C X: 157,310,958 I439V probably benign Het
Pkd1l1 T A 11: 8,947,251 S103C probably damaging Het
Plekha4 C T 7: 45,538,244 R176C probably damaging Het
Ppp1r3a T G 6: 14,718,249 S889R possibly damaging Het
Prol1 C A 5: 88,328,309 A186E unknown Het
Rbm39 C T 2: 156,167,583 R123H probably benign Het
Rtn4 T C 11: 29,693,687 S167P probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Smoc2 T C 17: 14,397,625 probably null Het
Sptbn2 A G 19: 4,748,636 T1998A possibly damaging Het
Tbc1d5 T A 17: 50,935,549 E173D probably damaging Het
Tsc2 A G 17: 24,631,995 probably null Het
Umps A T 16: 33,963,870 V71E probably damaging Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Wdfy4 C A 14: 33,109,519 E917* probably null Het
Zfhx2 T C 14: 55,064,803 K1908R possibly damaging Het
Zfp511 A C 7: 140,039,382 D204A probably benign Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 unclassified probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89944170 missense probably damaging 1.00
R1568:Atp8b2 UTSW 3 89949848 missense probably damaging 0.98
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89946031 missense probably benign
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3742:Atp8b2 UTSW 3 89946031 missense probably benign
R3896:Atp8b2 UTSW 3 89957319 missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89943672 missense possibly damaging 0.88
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACCTGGAACAATGAGG -3'
(R):5'- TTCCAGGAAGTTGCCAACAC -3'

Sequencing Primer
(F):5'- CACCTGGAACAATGAGGAATCCTG -3'
(R):5'- TCTCATTCTGCAGGTAAGTGAC -3'
Posted On2015-01-23