Incidental Mutation 'R0330:Arhgef12'
ID25999
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission 038539-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R0330 (G1)
Quality Score223
Status Not validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43020686 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 168 (H168Q)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072767
AA Change: H168Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: H168Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: H168Q

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217502
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
Acaa1b T C 9: 119,153,970 N120S probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
AI661453 G A 17: 47,446,646 R76Q probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap12 T A 18: 6,039,382 D455V probably damaging Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Arhgef2 A G 3: 88,642,501 H592R probably damaging Het
BC049715 A G 6: 136,840,037 T92A possibly damaging Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Capn8 T A 1: 182,630,138 I689N probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cep57 G A 9: 13,816,985 R148W probably damaging Het
Cftr T A 6: 18,226,097 M318K probably null Het
Chd3 T G 11: 69,356,333 D1003A probably damaging Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cldn13 A G 5: 134,915,322 V3A probably benign Het
Col17a1 T C 19: 47,670,432 T413A probably benign Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Fanca A T 8: 123,274,172 C1156* probably null Het
Flot2 T A 11: 78,058,958 I322N possibly damaging Het
Fstl5 T C 3: 76,707,753 V707A possibly damaging Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Gtf2i T C 5: 134,251,886 E518G probably damaging Het
Hrasls5 T A 19: 7,637,298 probably null Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Impg2 A G 16: 56,252,264 Y353C probably damaging Het
Kank1 A G 19: 25,424,313 K1095E probably benign Het
Kcnh4 C T 11: 100,757,743 C45Y probably damaging Het
Kif13b A G 14: 64,803,220 T1590A probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrp1b A T 2: 40,701,761 C73* probably null Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Med12l A G 3: 59,227,702 E757G probably damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myof A C 19: 37,935,878 I1297S probably damaging Het
Nacad A G 11: 6,600,903 S763P probably benign Het
Nbea A G 3: 55,642,817 V2730A probably benign Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr370 A G 8: 83,541,513 Y123C probably damaging Het
Olfr828 A G 9: 18,815,641 Y218H probably damaging Het
Optn A T 2: 5,034,255 N352K possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plb1 T A 5: 32,355,357 F1353Y probably damaging Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pygo2 T A 3: 89,433,154 N286K possibly damaging Het
Rttn G A 18: 88,986,080 probably null Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Sidt2 A G 9: 45,954,902 I2T probably benign Het
Slc12a3 A T 8: 94,346,346 N699I possibly damaging Het
Slc25a30 G A 14: 75,762,672 Q285* probably null Het
Slc4a9 A T 18: 36,535,539 H724L probably damaging Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stac3 C A 10: 127,507,747 probably null Het
Stk32a A G 18: 43,313,501 K339E probably benign Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tbc1d16 A G 11: 119,158,729 probably null Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Trappc12 A G 12: 28,747,260 V91A probably benign Het
Trim46 G T 3: 89,236,513 P536Q probably damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Vps4a A C 8: 107,043,066 I336L probably benign Het
Xylb T C 9: 119,381,587 S379P probably damaging Het
Zbtb37 T C 1: 161,032,496 T80A probably benign Het
Zfhx3 A G 8: 108,948,957 D2213G probably damaging Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Zfp804b A T 5: 6,771,029 I642N possibly damaging Het
Zfp804b A T 5: 6,771,994 N356K possibly damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCACAGTTGGATGTGCTTTCTC -3'
(R):5'- TGGGTACAGTCCTCACTACCACAG -3'

Sequencing Primer
(F):5'- aaacaaacaaacaaacacccac -3'
(R):5'- GTCCTCACTACCACAGATAAAGAG -3'
Posted On2013-04-16