Incidental Mutation 'R0330:Nacad'
ID26002
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene NameNAC alpha domain containing
SynonymsmKIAA0363
MMRRC Submission 038539-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0330 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6597823-6606053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6600903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 763 (S763P)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000388] [ENSMUST00000045713] [ENSMUST00000109721] [ENSMUST00000109722]
Predicted Effect probably benign
Transcript: ENSMUST00000000388
SMART Domains Protein: ENSMUSP00000000388
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Blast:PTB 60 230 2e-35 BLAST
low complexity region 242 252 N/A INTRINSIC
Pfam:CCM2_C 296 396 8.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045713
AA Change: S763P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: S763P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109721
SMART Domains Protein: ENSMUSP00000105343
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109722
SMART Domains Protein: ENSMUSP00000105344
Gene: ENSMUSG00000000378

DomainStartEndE-ValueType
Blast:PTB 2 166 2e-32 BLAST
low complexity region 178 188 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
PDB:4FQN|D 245 324 5e-52 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
Acaa1b T C 9: 119,153,970 N120S probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
AI661453 G A 17: 47,446,646 R76Q probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap12 T A 18: 6,039,382 D455V probably damaging Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Arhgef12 A C 9: 43,020,686 H168Q probably damaging Het
Arhgef2 A G 3: 88,642,501 H592R probably damaging Het
BC049715 A G 6: 136,840,037 T92A possibly damaging Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Capn8 T A 1: 182,630,138 I689N probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cep57 G A 9: 13,816,985 R148W probably damaging Het
Cftr T A 6: 18,226,097 M318K probably null Het
Chd3 T G 11: 69,356,333 D1003A probably damaging Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cldn13 A G 5: 134,915,322 V3A probably benign Het
Col17a1 T C 19: 47,670,432 T413A probably benign Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Fanca A T 8: 123,274,172 C1156* probably null Het
Flot2 T A 11: 78,058,958 I322N possibly damaging Het
Fstl5 T C 3: 76,707,753 V707A possibly damaging Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Gtf2i T C 5: 134,251,886 E518G probably damaging Het
Hrasls5 T A 19: 7,637,298 probably null Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Impg2 A G 16: 56,252,264 Y353C probably damaging Het
Kank1 A G 19: 25,424,313 K1095E probably benign Het
Kcnh4 C T 11: 100,757,743 C45Y probably damaging Het
Kif13b A G 14: 64,803,220 T1590A probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrp1b A T 2: 40,701,761 C73* probably null Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Med12l A G 3: 59,227,702 E757G probably damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myof A C 19: 37,935,878 I1297S probably damaging Het
Nbea A G 3: 55,642,817 V2730A probably benign Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr370 A G 8: 83,541,513 Y123C probably damaging Het
Olfr828 A G 9: 18,815,641 Y218H probably damaging Het
Optn A T 2: 5,034,255 N352K possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plb1 T A 5: 32,355,357 F1353Y probably damaging Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pygo2 T A 3: 89,433,154 N286K possibly damaging Het
Rttn G A 18: 88,986,080 probably null Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Sidt2 A G 9: 45,954,902 I2T probably benign Het
Slc12a3 A T 8: 94,346,346 N699I possibly damaging Het
Slc25a30 G A 14: 75,762,672 Q285* probably null Het
Slc4a9 A T 18: 36,535,539 H724L probably damaging Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stac3 C A 10: 127,507,747 probably null Het
Stk32a A G 18: 43,313,501 K339E probably benign Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tbc1d16 A G 11: 119,158,729 probably null Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Trappc12 A G 12: 28,747,260 V91A probably benign Het
Trim46 G T 3: 89,236,513 P536Q probably damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Vps4a A C 8: 107,043,066 I336L probably benign Het
Xylb T C 9: 119,381,587 S379P probably damaging Het
Zbtb37 T C 1: 161,032,496 T80A probably benign Het
Zfhx3 A G 8: 108,948,957 D2213G probably damaging Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Zfp804b A T 5: 6,771,029 I642N possibly damaging Het
Zfp804b A T 5: 6,771,994 N356K possibly damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1583:Nacad UTSW 11 6601185 missense probably benign 0.08
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5864:Nacad UTSW 11 6600581 missense probably benign
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6525:Nacad UTSW 11 6602255 missense probably damaging 1.00
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6931:Nacad UTSW 11 6601877 missense probably benign 0.14
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAAGCCTTGCAGCAATGAAGGTG -3'
(R):5'- TGTGTCACAGTACTCCCTGATGTCC -3'

Sequencing Primer
(F):5'- TGATGCTACTGGGGCAAC -3'
(R):5'- GGTATTACCTCCATCCCCACAAAG -3'
Posted On2013-04-16