Incidental Mutation 'R2890:Lamp1'
ID260063
Institutional Source Beutler Lab
Gene Symbol Lamp1
Ensembl Gene ENSMUSG00000031447
Gene Namelysosomal-associated membrane protein 1
SynonymsLamp-1, CD107a
MMRRC Submission 040478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2890 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13159161-13175338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13173891 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 341 (L341H)
Ref Sequence ENSEMBL: ENSMUSP00000033824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033824] [ENSMUST00000165605] [ENSMUST00000209691] [ENSMUST00000209895] [ENSMUST00000210317] [ENSMUST00000211128]
Predicted Effect probably damaging
Transcript: ENSMUST00000033824
AA Change: L341H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033824
Gene: ENSMUSG00000031447
AA Change: L341H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lamp 106 406 4.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165605
SMART Domains Protein: ENSMUSP00000130324
Gene: ENSMUSG00000038515

DomainStartEndE-ValueType
TBC 71 287 2.03e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209465
Predicted Effect probably benign
Transcript: ENSMUST00000209516
Predicted Effect probably benign
Transcript: ENSMUST00000209691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209709
Predicted Effect probably benign
Transcript: ENSMUST00000209895
Predicted Effect probably benign
Transcript: ENSMUST00000210317
Predicted Effect probably benign
Transcript: ENSMUST00000211128
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930480E11Rik A T X: 78,370,682 I338F probably damaging Het
A1cf A G 19: 31,918,017 I167V probably benign Het
Adamts20 C T 15: 94,330,578 R996H probably benign Het
Amdhd1 T C 10: 93,527,264 K321E probably benign Het
Baz1a T C 12: 54,898,517 H1351R probably benign Het
Cep63 T C 9: 102,618,827 D127G probably damaging Het
Chrm5 T C 2: 112,479,703 Y356C probably benign Het
Dock4 A T 12: 40,623,801 probably null Het
Dync1h1 T C 12: 110,616,891 L474P probably damaging Het
Fzd7 C T 1: 59,484,434 A492V probably benign Het
Greb1 A G 12: 16,704,478 L876P probably damaging Het
Grik4 T C 9: 42,671,219 T144A probably damaging Het
Gusb T C 5: 130,000,502 H146R probably damaging Het
Hspg2 T C 4: 137,549,574 V2835A probably damaging Het
Lcn10 T C 2: 25,683,630 L73P probably damaging Het
Nostrin A G 2: 69,180,905 T347A probably benign Het
Olfr1287 A T 2: 111,449,289 I50F probably benign Het
Pcdhb9 G A 18: 37,403,326 C791Y probably benign Het
Phex T C X: 157,310,958 I439V probably benign Het
Rbsn C T 6: 92,207,123 V70M possibly damaging Het
Slc25a1 A T 16: 17,926,099 L251Q probably damaging Het
Slc35a5 A G 16: 45,151,560 C114R probably damaging Het
Srek1ip1 A T 13: 104,834,250 I70L probably benign Het
Taf4b T C 18: 14,804,792 S278P probably damaging Het
Ttn T C 2: 76,896,154 probably benign Het
Vmn2r13 T C 5: 109,191,974 D45G possibly damaging Het
Vmn2r66 C T 7: 85,011,819 probably null Het
Ylpm1 G T 12: 85,029,813 R646L probably damaging Het
Zfp51 C G 17: 21,463,856 C244W probably damaging Het
Zfp619 C A 7: 39,534,969 T141K probably benign Het
Other mutations in Lamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Lamp1 APN 8 13171195 unclassified probably benign
IGL01516:Lamp1 APN 8 13173863 missense probably damaging 0.98
IGL01541:Lamp1 APN 8 13165905 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0127:Lamp1 UTSW 8 13174491 missense probably damaging 1.00
R0744:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R0836:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R1875:Lamp1 UTSW 8 13167257 missense probably damaging 1.00
R1945:Lamp1 UTSW 8 13172545 missense probably benign 0.40
R2887:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2888:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2889:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R4235:Lamp1 UTSW 8 13167192 missense possibly damaging 0.66
R4817:Lamp1 UTSW 8 13172541 missense probably benign 0.43
R5654:Lamp1 UTSW 8 13171388 splice site probably null
R5942:Lamp1 UTSW 8 13173941 missense probably damaging 1.00
R6538:Lamp1 UTSW 8 13171285 missense probably benign 0.00
R6917:Lamp1 UTSW 8 13172563 missense probably damaging 1.00
R6977:Lamp1 UTSW 8 13173661 missense probably damaging 0.98
R7262:Lamp1 UTSW 8 13167296 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCTGATGCCCTAGGTGAG -3'
(R):5'- CTGTCTTTGCAGAGGAAAAGG -3'

Sequencing Primer
(F):5'- TAGGTGAGACTGGCTTCCTCC -3'
(R):5'- TGCTACTTACCAGACCCA -3'
Posted On2015-01-23