Incidental Mutation 'R2891:Klf7'
ID 260086
Institutional Source Beutler Lab
Gene Symbol Klf7
Ensembl Gene ENSMUSG00000025959
Gene Name Kruppel-like transcription factor 7 (ubiquitous)
Synonyms 9830124P08Rik
MMRRC Submission 040479-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2891 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 64068606-64161441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64081521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 269 (Y269C)
Ref Sequence ENSEMBL: ENSMUSP00000109720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055001] [ENSMUST00000114086]
AlphaFold Q99JB0
Predicted Effect probably damaging
Transcript: ENSMUST00000055001
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054674
Gene: ENSMUSG00000025959
AA Change: Y269C

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
ZnF_C2H2 248 272 4.94e-5 SMART
ZnF_C2H2 278 300 6.78e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114086
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959
AA Change: Y269C

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184798
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice die within 3 days of life, showing lack of gastic milk, hypopnea, cyanosis, olfactory bulb hypoplasia, no response to tail clamping, impaired axon projection in the olfactory and visual systems, cerebral cortex and hippocampus, and reduced dendritic branching in the hippocampus. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,841,366 (GRCm39) Y816H probably damaging Het
Clcn6 C T 4: 148,097,073 (GRCm39) probably null Het
Farp1 C T 14: 121,494,148 (GRCm39) A543V probably damaging Het
Hhat T C 1: 192,277,394 (GRCm39) Y355C probably damaging Het
Ireb2 A T 9: 54,807,274 (GRCm39) H612L probably benign Het
Kcnj3 A T 2: 55,337,027 (GRCm39) I298F probably damaging Het
Kdr A G 5: 76,107,496 (GRCm39) F1016L probably damaging Het
Klhl9 T C 4: 88,639,207 (GRCm39) I345V probably benign Het
Miga2 A T 2: 30,268,306 (GRCm39) probably null Het
Nadk A G 4: 155,671,817 (GRCm39) N232S possibly damaging Het
Ncoa6 T A 2: 155,279,881 (GRCm39) D45V possibly damaging Het
Pcnx2 A G 8: 126,617,797 (GRCm39) S153P probably damaging Het
Per2 C A 1: 91,373,325 (GRCm39) Q154H probably damaging Het
Pik3ap1 G A 19: 41,364,500 (GRCm39) A73V probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Rapsn A T 2: 90,867,169 (GRCm39) D157V probably damaging Het
Shprh T G 10: 11,040,100 (GRCm39) S4R probably damaging Het
Taar8a G A 10: 23,953,028 (GRCm39) V211I probably benign Het
Vpreb3 C T 10: 75,779,056 (GRCm39) probably benign Het
Other mutations in Klf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Klf7 APN 1 64,081,476 (GRCm39) missense possibly damaging 0.65
IGL01684:Klf7 APN 1 64,160,051 (GRCm39) splice site probably benign
IGL01844:Klf7 APN 1 64,117,933 (GRCm39) missense probably benign 0.02
IGL03181:Klf7 APN 1 64,074,885 (GRCm39) missense possibly damaging 0.88
Esurientes UTSW 1 64,118,372 (GRCm39) missense possibly damaging 0.78
C9142:Klf7 UTSW 1 64,118,316 (GRCm39) missense possibly damaging 0.47
R1736:Klf7 UTSW 1 64,118,372 (GRCm39) missense possibly damaging 0.78
R1737:Klf7 UTSW 1 64,118,372 (GRCm39) missense possibly damaging 0.78
R1744:Klf7 UTSW 1 64,118,372 (GRCm39) missense possibly damaging 0.78
R2048:Klf7 UTSW 1 64,117,913 (GRCm39) missense possibly damaging 0.65
R5055:Klf7 UTSW 1 64,118,439 (GRCm39) missense probably benign 0.08
R5613:Klf7 UTSW 1 64,081,555 (GRCm39) missense probably damaging 0.98
R5782:Klf7 UTSW 1 64,081,570 (GRCm39) missense possibly damaging 0.81
R7369:Klf7 UTSW 1 64,160,300 (GRCm39) critical splice acceptor site probably null
R7470:Klf7 UTSW 1 64,081,472 (GRCm39) critical splice donor site probably null
R8501:Klf7 UTSW 1 64,118,322 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGACCCTGAAACTTTACTAC -3'
(R):5'- ATCTGAGAGGCCATCTGCTG -3'

Sequencing Primer
(F):5'- TTTCACCCTTGCAAGCAGTAGAG -3'
(R):5'- AGGCCATCTGCTGAGACTAG -3'
Posted On 2015-01-23