Incidental Mutation 'R0330:AI661453'
ID26013
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Nameexpressed sequence AI661453
Synonyms
MMRRC Submission 038539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R0330 (G1)
Quality Score194
Status Not validated
Chromosome17
Chromosomal Location47436615-47470638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47446646 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 76 (R76Q)
Ref Sequence ENSEMBL: ENSMUSP00000120133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
Predicted Effect probably damaging
Transcript: ENSMUST00000037701
AA Change: R76Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382
AA Change: R76Q

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150819
AA Change: R76Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: R76Q

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
Acaa1b T C 9: 119,153,970 N120S probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap12 T A 18: 6,039,382 D455V probably damaging Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Arhgef12 A C 9: 43,020,686 H168Q probably damaging Het
Arhgef2 A G 3: 88,642,501 H592R probably damaging Het
BC049715 A G 6: 136,840,037 T92A possibly damaging Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Capn8 T A 1: 182,630,138 I689N probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cep57 G A 9: 13,816,985 R148W probably damaging Het
Cftr T A 6: 18,226,097 M318K probably null Het
Chd3 T G 11: 69,356,333 D1003A probably damaging Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cldn13 A G 5: 134,915,322 V3A probably benign Het
Col17a1 T C 19: 47,670,432 T413A probably benign Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Fanca A T 8: 123,274,172 C1156* probably null Het
Flot2 T A 11: 78,058,958 I322N possibly damaging Het
Fstl5 T C 3: 76,707,753 V707A possibly damaging Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Gtf2i T C 5: 134,251,886 E518G probably damaging Het
Hrasls5 T A 19: 7,637,298 probably null Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Impg2 A G 16: 56,252,264 Y353C probably damaging Het
Kank1 A G 19: 25,424,313 K1095E probably benign Het
Kcnh4 C T 11: 100,757,743 C45Y probably damaging Het
Kif13b A G 14: 64,803,220 T1590A probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrp1b A T 2: 40,701,761 C73* probably null Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Med12l A G 3: 59,227,702 E757G probably damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myof A C 19: 37,935,878 I1297S probably damaging Het
Nacad A G 11: 6,600,903 S763P probably benign Het
Nbea A G 3: 55,642,817 V2730A probably benign Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr370 A G 8: 83,541,513 Y123C probably damaging Het
Olfr828 A G 9: 18,815,641 Y218H probably damaging Het
Optn A T 2: 5,034,255 N352K possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plb1 T A 5: 32,355,357 F1353Y probably damaging Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pygo2 T A 3: 89,433,154 N286K possibly damaging Het
Rttn G A 18: 88,986,080 probably null Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Sidt2 A G 9: 45,954,902 I2T probably benign Het
Slc12a3 A T 8: 94,346,346 N699I possibly damaging Het
Slc25a30 G A 14: 75,762,672 Q285* probably null Het
Slc4a9 A T 18: 36,535,539 H724L probably damaging Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stac3 C A 10: 127,507,747 probably null Het
Stk32a A G 18: 43,313,501 K339E probably benign Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tbc1d16 A G 11: 119,158,729 probably null Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Trappc12 A G 12: 28,747,260 V91A probably benign Het
Trim46 G T 3: 89,236,513 P536Q probably damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Vps4a A C 8: 107,043,066 I336L probably benign Het
Xylb T C 9: 119,381,587 S379P probably damaging Het
Zbtb37 T C 1: 161,032,496 T80A probably benign Het
Zfhx3 A G 8: 108,948,957 D2213G probably damaging Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Zfp804b A T 5: 6,771,029 I642N possibly damaging Het
Zfp804b A T 5: 6,771,994 N356K possibly damaging Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47466623 intron probably benign
IGL01995:AI661453 APN 17 47468517 intron probably benign
IGL02171:AI661453 APN 17 47466996 intron probably benign
IGL02411:AI661453 APN 17 47467338 intron probably benign
IGL02422:AI661453 APN 17 47467092 intron probably benign
IGL02609:AI661453 APN 17 47468372 intron probably benign
IGL02888:AI661453 APN 17 47467404 intron probably benign
IGL03024:AI661453 APN 17 47446588 missense probably damaging 1.00
R0077:AI661453 UTSW 17 47469362 intron probably benign
R0092:AI661453 UTSW 17 47467515 intron probably benign
R0144:AI661453 UTSW 17 47469299 intron probably benign
R0590:AI661453 UTSW 17 47467074 intron probably benign
R0839:AI661453 UTSW 17 47436827 missense probably null 0.97
R1350:AI661453 UTSW 17 47467928 nonsense probably null
R1436:AI661453 UTSW 17 47466702 intron probably benign
R1439:AI661453 UTSW 17 47466662 intron probably benign
R1643:AI661453 UTSW 17 47467866 intron probably benign
R1994:AI661453 UTSW 17 47467034 intron probably benign
R2145:AI661453 UTSW 17 47466098 intron probably benign
R2986:AI661453 UTSW 17 47466772 nonsense probably null
R4398:AI661453 UTSW 17 47468117 intron probably benign
R4809:AI661453 UTSW 17 47467187 intron probably benign
R4913:AI661453 UTSW 17 47468555 nonsense probably null
R4972:AI661453 UTSW 17 47466399 intron probably benign
R6430:AI661453 UTSW 17 47466797 intron probably benign
R6687:AI661453 UTSW 17 47467002 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCATTTCCACAAGCAATCTCATCG -3'
(R):5'- AGCTTCCTGCTATGAGTCTCAGCC -3'

Sequencing Primer
(F):5'- ACTGTGTTAGAGTGTGAAAGCCC -3'
(R):5'- ATGAGTCTCAGCCCTGCC -3'
Posted On2013-04-16