Incidental Mutation 'R2892:Trim80'
ID260135
Institutional Source Beutler Lab
Gene Symbol Trim80
Ensembl Gene ENSMUSG00000070332
Gene Nametripartite motif-containing 80
Synonyms4933422H20Rik
MMRRC Submission 040480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2892 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115440545-115448270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115448023 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 560 (T560A)
Ref Sequence ENSEMBL: ENSMUSP00000091442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093914
AA Change: T560A

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332
AA Change: T560A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 71 114 4.48e-7 SMART
Blast:BBOX 154 202 7e-22 BLAST
Pfam:zf-B_box 207 246 2.2e-10 PFAM
Blast:PRY 441 496 2e-18 BLAST
Pfam:SPRY 499 621 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175355
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,594,317 D232G probably damaging Het
Ank2 T C 3: 127,248,243 probably null Het
Atp6v0a4 T C 6: 38,053,017 E704G probably benign Het
Bbx A G 16: 50,224,741 Y378H probably damaging Het
Carmil3 T C 14: 55,498,313 V574A probably damaging Het
Cpz A G 5: 35,511,129 V379A probably damaging Het
Cyp4f15 A G 17: 32,686,208 D55G probably benign Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Defa30 A T 8: 21,134,663 M1L probably damaging Het
Fzd8 G T 18: 9,214,514 G532V probably damaging Het
Gcfc2 T C 6: 81,956,913 F717S possibly damaging Het
Gckr T C 5: 31,326,472 V563A probably benign Het
Ighv1-24 T G 12: 114,773,059 K74Q probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Mmrn2 T G 14: 34,396,630 F158V probably benign Het
Mug1 G A 6: 121,840,070 V33M possibly damaging Het
Myom1 T C 17: 71,034,653 S136P probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr815 A G 10: 129,901,940 Y257H possibly damaging Het
Olfr845 A G 9: 19,338,738 T93A probably benign Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Pde8b T C 13: 95,034,259 D633G probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plrg1 C A 3: 83,071,240 Q438K probably damaging Het
Plxna4 A G 6: 32,517,037 Y215H probably damaging Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Snrnp200 T C 2: 127,231,777 L1365P probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Ttll2 T C 17: 7,352,699 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Zfp82 G A 7: 30,056,439 T406I probably damaging Het
Other mutations in Trim80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Trim80 APN 11 115447665 missense probably benign 0.21
IGL00921:Trim80 APN 11 115447664 missense probably benign 0.00
IGL02948:Trim80 APN 11 115441593 missense possibly damaging 0.81
IGL03037:Trim80 APN 11 115441593 missense possibly damaging 0.81
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0409:Trim80 UTSW 11 115441213 missense probably damaging 1.00
R1069:Trim80 UTSW 11 115448083 missense probably damaging 1.00
R1832:Trim80 UTSW 11 115446793 missense probably benign
R1952:Trim80 UTSW 11 115441329 nonsense probably null
R4301:Trim80 UTSW 11 115445113 critical splice donor site probably null
R4748:Trim80 UTSW 11 115448138 missense possibly damaging 0.84
R4795:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4819:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4910:Trim80 UTSW 11 115446455 missense probably damaging 0.99
R5245:Trim80 UTSW 11 115441572 missense probably damaging 1.00
R5288:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5384:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5386:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5508:Trim80 UTSW 11 115445078 missense probably benign 0.06
R5645:Trim80 UTSW 11 115446785 missense probably damaging 1.00
R5785:Trim80 UTSW 11 115446475 nonsense probably null
R5822:Trim80 UTSW 11 115447921 missense probably damaging 0.99
R6754:Trim80 UTSW 11 115448174 missense probably damaging 1.00
R6785:Trim80 UTSW 11 115441201 missense probably damaging 0.99
R6788:Trim80 UTSW 11 115448017 missense probably benign 0.07
R7336:Trim80 UTSW 11 115441216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGTCACTACTGGGAG -3'
(R):5'- GTCTAACTTTATTGGCAGCAAGC -3'

Sequencing Primer
(F):5'- AGGCTGAGGTGTCCAACTC -3'
(R):5'- GCGCTACCTATGCCTCAGGATAC -3'
Posted On2015-01-23