Incidental Mutation 'R2892:Pde8b'
ID260136
Institutional Source Beutler Lab
Gene Symbol Pde8b
Ensembl Gene ENSMUSG00000021684
Gene Namephosphodiesterase 8B
SynonymsB230331L10Rik, C030047E14Rik
MMRRC Submission 040480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R2892 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95024454-95250336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95034259 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 633 (D633G)
Ref Sequence ENSEMBL: ENSMUSP00000125191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022192] [ENSMUST00000067082] [ENSMUST00000159608] [ENSMUST00000162153] [ENSMUST00000162292] [ENSMUST00000162412] [ENSMUST00000172104]
Predicted Effect probably damaging
Transcript: ENSMUST00000022192
AA Change: D633G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022192
Gene: ENSMUSG00000021684
AA Change: D633G

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.9e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 748 3.01e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067082
AA Change: D660G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070465
Gene: ENSMUSG00000021684
AA Change: D660G

DomainStartEndE-ValueType
Pfam:PDE8 1 47 1.4e-32 PFAM
low complexity region 75 98 N/A INTRINSIC
Blast:REC 112 235 6e-45 BLAST
PAS 249 316 3.59e-3 SMART
Blast:HDc 447 508 1e-20 BLAST
HDc 592 775 3.01e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159608
AA Change: D633G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125191
Gene: ENSMUSG00000021684
AA Change: D633G

DomainStartEndE-ValueType
Pfam:PDE8 1 52 1.7e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.1e-15 PFAM
Blast:HDc 420 481 1e-20 BLAST
HDc 565 666 9.37e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162153
AA Change: D575G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124704
Gene: ENSMUSG00000021684
AA Change: D575G

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.6e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 362 423 1e-20 BLAST
HDc 507 690 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162292
AA Change: D583G

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124068
Gene: ENSMUSG00000021684
AA Change: D583G

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.1e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.6e-15 PFAM
Blast:HDc 370 431 1e-20 BLAST
HDc 515 698 3.01e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162412
AA Change: D525G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124409
Gene: ENSMUSG00000021684
AA Change: D525G

DomainStartEndE-ValueType
Pfam:Response_reg 29 147 2.3e-15 PFAM
PAS 164 231 3.59e-3 SMART
Blast:HDc 312 373 1e-20 BLAST
HDc 457 640 3.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162670
SMART Domains Protein: ENSMUSP00000125237
Gene: ENSMUSG00000021684

DomainStartEndE-ValueType
Pfam:PDEase_I 1 182 6.6e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162882
Predicted Effect probably damaging
Transcript: ENSMUST00000172104
AA Change: D625G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128987
Gene: ENSMUSG00000021684
AA Change: D625G

DomainStartEndE-ValueType
Pfam:PDE8 1 52 2.2e-39 PFAM
low complexity region 75 98 N/A INTRINSIC
Pfam:Response_reg 134 252 2.8e-15 PFAM
PAS 269 336 3.59e-3 SMART
HDc 557 740 3.01e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cyclic nucleotide phosphodiesterase (PDE) that catalyzes the hydrolysis of the second messenger cAMP. The encoded protein, which does not hydrolyze cGMP, is resistant to several PDE inhibitors. Defects in this gene are a cause of autosomal dominant striatal degeneration (ADSD). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased uring corticosterone, decreased serum adrenocorticotropin and decreased sensitivity to a PDE8-selective inhibitor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,594,317 D232G probably damaging Het
Ank2 T C 3: 127,248,243 probably null Het
Atp6v0a4 T C 6: 38,053,017 E704G probably benign Het
Bbx A G 16: 50,224,741 Y378H probably damaging Het
Carmil3 T C 14: 55,498,313 V574A probably damaging Het
Cpz A G 5: 35,511,129 V379A probably damaging Het
Cyp4f15 A G 17: 32,686,208 D55G probably benign Het
Dcun1d2 A T 8: 13,278,649 I86N probably damaging Het
Defa30 A T 8: 21,134,663 M1L probably damaging Het
Fzd8 G T 18: 9,214,514 G532V probably damaging Het
Gcfc2 T C 6: 81,956,913 F717S possibly damaging Het
Gckr T C 5: 31,326,472 V563A probably benign Het
Ighv1-24 T G 12: 114,773,059 K74Q probably benign Het
Kcnj3 A T 2: 55,447,015 I298F probably damaging Het
Miga2 A T 2: 30,378,294 probably null Het
Mmrn2 T G 14: 34,396,630 F158V probably benign Het
Mug1 G A 6: 121,840,070 V33M possibly damaging Het
Myom1 T C 17: 71,034,653 S136P probably damaging Het
Nadk A G 4: 155,587,360 N232S possibly damaging Het
Olfr815 A G 10: 129,901,940 Y257H possibly damaging Het
Olfr845 A G 9: 19,338,738 T93A probably benign Het
Pcnx2 A G 8: 125,891,058 S153P probably damaging Het
Pik3ap1 G A 19: 41,376,061 A73V probably benign Het
Plrg1 C A 3: 83,071,240 Q438K probably damaging Het
Plxna4 A G 6: 32,517,037 Y215H probably damaging Het
Rapsn A T 2: 91,036,824 D157V probably damaging Het
Rock1 G A 18: 10,072,863 Q1161* probably null Het
Snrnp200 T C 2: 127,231,777 L1365P probably damaging Het
Srcap T C 7: 127,539,065 S1136P probably damaging Het
Trim80 A G 11: 115,448,023 T560A possibly damaging Het
Ttll2 T C 17: 7,352,699 probably null Het
Usp8 A T 2: 126,758,155 Q998L probably damaging Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Zfp82 G A 7: 30,056,439 T406I probably damaging Het
Other mutations in Pde8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Pde8b APN 13 95034367 missense probably damaging 1.00
IGL01517:Pde8b APN 13 95100887 critical splice donor site probably null
IGL01736:Pde8b APN 13 95030402 missense probably damaging 1.00
IGL01756:Pde8b APN 13 95046387 missense probably damaging 1.00
IGL01867:Pde8b APN 13 95100938 missense probably damaging 0.99
IGL01939:Pde8b APN 13 95095724 missense probably damaging 0.98
IGL02026:Pde8b APN 13 95034361 missense probably damaging 1.00
IGL02685:Pde8b APN 13 95026120 makesense probably null
IGL02830:Pde8b APN 13 95052901 missense probably benign 0.02
IGL02966:Pde8b APN 13 95095648 missense probably damaging 0.96
IGL03003:Pde8b APN 13 95041957 missense probably damaging 1.00
IGL03064:Pde8b APN 13 95046398 missense probably damaging 1.00
IGL03349:Pde8b APN 13 95043043 splice site probably benign
R0356:Pde8b UTSW 13 95046454 missense probably damaging 0.96
R0464:Pde8b UTSW 13 95104698 missense probably damaging 1.00
R0711:Pde8b UTSW 13 95107817 missense possibly damaging 0.87
R1436:Pde8b UTSW 13 95026170 missense probably benign 0.00
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1467:Pde8b UTSW 13 95034172 missense probably damaging 0.99
R1494:Pde8b UTSW 13 95047796 missense probably damaging 1.00
R1546:Pde8b UTSW 13 95046443 missense probably damaging 1.00
R1699:Pde8b UTSW 13 95032866 missense probably damaging 1.00
R1795:Pde8b UTSW 13 95042019 missense probably benign 0.10
R1879:Pde8b UTSW 13 95085215 missense possibly damaging 0.95
R2184:Pde8b UTSW 13 95026215 missense probably damaging 1.00
R2223:Pde8b UTSW 13 95043447 missense probably damaging 1.00
R3034:Pde8b UTSW 13 95222767 missense probably damaging 1.00
R4204:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4206:Pde8b UTSW 13 95222545 missense probably benign 0.22
R4623:Pde8b UTSW 13 95041939 missense possibly damaging 0.69
R4711:Pde8b UTSW 13 95030450 missense probably benign 0.00
R5133:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5134:Pde8b UTSW 13 95086742 missense probably benign 0.05
R5314:Pde8b UTSW 13 95086853 missense possibly damaging 0.89
R5342:Pde8b UTSW 13 95041990 missense probably damaging 0.99
R5376:Pde8b UTSW 13 95026146 missense probably benign 0.00
R5806:Pde8b UTSW 13 95042040 missense probably damaging 1.00
R5830:Pde8b UTSW 13 95041890 missense probably benign 0.01
R6021:Pde8b UTSW 13 95026162 missense possibly damaging 0.47
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6035:Pde8b UTSW 13 95027597 intron probably benign
R6129:Pde8b UTSW 13 95041959 missense probably damaging 0.98
R6181:Pde8b UTSW 13 95086808 missense probably benign 0.36
R6313:Pde8b UTSW 13 95042000 nonsense probably null
R6849:Pde8b UTSW 13 95047799 missense possibly damaging 0.89
R6914:Pde8b UTSW 13 95086844 missense probably benign 0.06
R6999:Pde8b UTSW 13 95086834 missense possibly damaging 0.91
R7149:Pde8b UTSW 13 95086841 missense probably benign 0.03
R7275:Pde8b UTSW 13 95042934 missense probably damaging 1.00
R7483:Pde8b UTSW 13 95027743 missense probably damaging 1.00
R7553:Pde8b UTSW 13 95086750 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATAACCTGATACAGTGAAGAGCCAC -3'
(R):5'- ACAGAGATGGATGCTGGTGTC -3'

Sequencing Primer
(F):5'- AGTGAAGAGCCACTGTTTCATTCC -3'
(R):5'- GTGTCTAGAAGCCTGTGAATAATG -3'
Posted On2015-01-23