Incidental Mutation 'R2878:Kcns1'
ID260165
Institutional Source Beutler Lab
Gene Symbol Kcns1
Ensembl Gene ENSMUSG00000040164
Gene NameK+ voltage-gated channel, subfamily S, 1
SynonymsKv9.1
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164163619-164171113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164164762 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 427 (I427T)
Ref Sequence ENSEMBL: ENSMUSP00000038901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045196]
Predicted Effect probably damaging
Transcript: ENSMUST00000045196
AA Change: I427T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038901
Gene: ENSMUSG00000040164
AA Change: I427T

DomainStartEndE-ValueType
BTB 19 128 7.07e-7 SMART
low complexity region 160 175 N/A INTRINSIC
Pfam:Ion_trans 188 439 2e-44 PFAM
Pfam:Ion_trans_2 349 433 5e-13 PFAM
low complexity region 455 468 N/A INTRINSIC
Meta Mutation Damage Score 0.398 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Kcns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kcns1 UTSW 2 164168643 missense probably benign 0.00
R0135:Kcns1 UTSW 2 164164955 missense possibly damaging 0.90
R0241:Kcns1 UTSW 2 164168380 missense probably damaging 1.00
R1966:Kcns1 UTSW 2 164168535 missense probably damaging 1.00
R2877:Kcns1 UTSW 2 164164762 missense probably damaging 1.00
R3157:Kcns1 UTSW 2 164164945 missense probably damaging 1.00
R4013:Kcns1 UTSW 2 164168257 missense probably damaging 1.00
R4451:Kcns1 UTSW 2 164168678 missense possibly damaging 0.46
R4873:Kcns1 UTSW 2 164168101 missense probably damaging 1.00
R4875:Kcns1 UTSW 2 164168101 missense probably damaging 1.00
R5270:Kcns1 UTSW 2 164168329 missense probably benign 0.37
R5493:Kcns1 UTSW 2 164167979 missense probably benign 0.02
R5775:Kcns1 UTSW 2 164164766 missense probably damaging 0.99
R6931:Kcns1 UTSW 2 164164838 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTAGCTGATTCCCAGGCTG -3'
(R):5'- GAAAACGAGGGCTTTCACAC -3'

Sequencing Primer
(F):5'- AGATTTTGCAGGCTCCCG -3'
(R):5'- GAGGGCTTTCACACAATCCCTG -3'
Posted On2015-01-23