Incidental Mutation 'R0330:Rttn'
ID26017
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission 038539-MU
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0330 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 88986080 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
Predicted Effect probably null
Transcript: ENSMUST00000023828
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 88.0%
Validation Efficiency
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,883,631 I400F probably benign Het
4833423E24Rik T A 2: 85,518,551 R72S probably benign Het
Acaa1b T C 9: 119,153,970 N120S probably damaging Het
Acvr1c T C 2: 58,284,838 T313A probably damaging Het
Adamtsl3 A T 7: 82,521,990 D417V probably damaging Het
Adgrf4 A T 17: 42,667,313 C380S probably damaging Het
AI597479 T G 1: 43,111,117 L129R probably benign Het
AI661453 G A 17: 47,446,646 R76Q probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Anxa7 A C 14: 20,469,498 probably null Het
Arhgap12 T A 18: 6,039,382 D455V probably damaging Het
Arhgap22 A G 14: 33,369,417 R650G possibly damaging Het
Arhgef12 A C 9: 43,020,686 H168Q probably damaging Het
Arhgef2 A G 3: 88,642,501 H592R probably damaging Het
BC049715 A G 6: 136,840,037 T92A possibly damaging Het
Bcr C T 10: 75,181,634 T1209I possibly damaging Het
Bmpr1a C T 14: 34,429,777 S185N probably benign Het
Calcoco1 A T 15: 102,715,763 M246K probably benign Het
Capn8 T A 1: 182,630,138 I689N probably benign Het
Ccno T A 13: 112,989,996 L333Q probably damaging Het
Cep57 G A 9: 13,816,985 R148W probably damaging Het
Cftr T A 6: 18,226,097 M318K probably null Het
Chd3 T G 11: 69,356,333 D1003A probably damaging Het
Ckmt2 T A 13: 91,863,203 D96V possibly damaging Het
Cldn13 A G 5: 134,915,322 V3A probably benign Het
Col17a1 T C 19: 47,670,432 T413A probably benign Het
Cpne5 A T 17: 29,211,660 L92H probably damaging Het
Dnaaf2 C A 12: 69,197,744 R181L probably damaging Het
Erbin C A 13: 103,868,865 C114F probably damaging Het
Fanca A T 8: 123,274,172 C1156* probably null Het
Flot2 T A 11: 78,058,958 I322N possibly damaging Het
Fstl5 T C 3: 76,707,753 V707A possibly damaging Het
Gli3 T G 13: 15,723,558 L741R probably damaging Het
Gmip G T 8: 69,810,818 S70I probably benign Het
Gnptab T C 10: 88,440,309 S1153P probably damaging Het
Gramd1a T C 7: 31,138,254 D360G possibly damaging Het
Gtf2i T C 5: 134,251,886 E518G probably damaging Het
Hrasls5 T A 19: 7,637,298 probably null Het
Hsp90b1 T C 10: 86,694,155 E226G probably damaging Het
Impg2 A G 16: 56,252,264 Y353C probably damaging Het
Kank1 A G 19: 25,424,313 K1095E probably benign Het
Kcnh4 C T 11: 100,757,743 C45Y probably damaging Het
Kif13b A G 14: 64,803,220 T1590A probably benign Het
Lpin3 T C 2: 160,905,305 V827A probably benign Het
Lrp1b A T 2: 40,701,761 C73* probably null Het
Mcm8 A G 2: 132,819,994 K83E possibly damaging Het
Med12l A G 3: 59,227,702 E757G probably damaging Het
Mep1a A G 17: 43,497,898 probably null Het
Mtor T A 4: 148,484,380 V1119E probably benign Het
Mybpc2 C T 7: 44,509,029 A710T possibly damaging Het
Myof A C 19: 37,935,878 I1297S probably damaging Het
Nacad A G 11: 6,600,903 S763P probably benign Het
Nbea A G 3: 55,642,817 V2730A probably benign Het
Nbeal1 A G 1: 60,268,063 Y1684C probably damaging Het
Olfr1015 T A 2: 85,785,803 C97* probably null Het
Olfr123 A T 17: 37,795,989 M182L probably benign Het
Olfr370 A G 8: 83,541,513 Y123C probably damaging Het
Olfr828 A G 9: 18,815,641 Y218H probably damaging Het
Optn A T 2: 5,034,255 N352K possibly damaging Het
Pcif1 G T 2: 164,889,444 R466L probably damaging Het
Phxr2 T C 10: 99,126,117 probably benign Het
Plb1 T A 5: 32,355,357 F1353Y probably damaging Het
Plec A G 15: 76,191,418 probably null Het
Polr1a T A 6: 71,966,416 C1212S possibly damaging Het
Primpol A T 8: 46,610,461 N53K probably damaging Het
Pygo2 T A 3: 89,433,154 N286K possibly damaging Het
Serpinb3b G T 1: 107,159,703 N25K probably damaging Het
Sidt2 A G 9: 45,954,902 I2T probably benign Het
Slc12a3 A T 8: 94,346,346 N699I possibly damaging Het
Slc25a30 G A 14: 75,762,672 Q285* probably null Het
Slc4a9 A T 18: 36,535,539 H724L probably damaging Het
Ssbp2 T A 13: 91,680,579 probably null Het
Stac3 C A 10: 127,507,747 probably null Het
Stk32a A G 18: 43,313,501 K339E probably benign Het
Stoml2 A G 4: 43,030,238 probably null Het
Syne2 G T 12: 75,966,953 G2974C probably benign Het
Tbc1d16 A G 11: 119,158,729 probably null Het
Tfdp2 T G 9: 96,306,893 F200V probably damaging Het
Tie1 C A 4: 118,484,727 R175L probably benign Het
Trappc12 A G 12: 28,747,260 V91A probably benign Het
Trim46 G T 3: 89,236,513 P536Q probably damaging Het
Tshz3 T A 7: 36,770,033 D482E probably benign Het
Tspan33 T C 6: 29,711,092 probably null Het
Unc80 T C 1: 66,674,087 L2788P possibly damaging Het
Utp20 T A 10: 88,817,979 T260S probably benign Het
Vmn2r118 G T 17: 55,610,717 T265K probably damaging Het
Vmn2r98 A C 17: 19,066,347 H369P probably benign Het
Vps39 A T 2: 120,338,787 Y245N possibly damaging Het
Vps4a A C 8: 107,043,066 I336L probably benign Het
Xylb T C 9: 119,381,587 S379P probably damaging Het
Zbtb37 T C 1: 161,032,496 T80A probably benign Het
Zfhx3 A G 8: 108,948,957 D2213G probably damaging Het
Zfp729a G T 13: 67,620,354 H585Q probably damaging Het
Zfp804b A T 5: 6,771,029 I642N possibly damaging Het
Zfp804b A T 5: 6,771,994 N356K possibly damaging Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 intron probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 intron probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R6994:Rttn UTSW 18 89028899 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCAGCAGGTAACAGCAAGTC -3'
(R):5'- GCAACAGAGAGTACCTCAAACTGTGAC -3'

Sequencing Primer
(F):5'- TTCCAGTGGAAGTAGTAGTCACAC -3'
(R):5'- GTACCTCAAACTGTGACTGACAAG -3'
Posted On2013-04-16