Incidental Mutation 'R2878:Nat6'
ID260177
Institutional Source Beutler Lab
Gene Symbol Nat6
Ensembl Gene ENSMUSG00000079334
Gene NameN-acetyltransferase 6
Synonyms
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107578887-107584050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107583168 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 87 (E87D)
Ref Sequence ENSEMBL: ENSMUSP00000122321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010192] [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000144392] [ENSMUST00000148440] [ENSMUST00000149487] [ENSMUST00000149638] [ENSMUST00000195725]
Predicted Effect probably benign
Transcript: ENSMUST00000010192
SMART Domains Protein: ENSMUSP00000010192
Gene: ENSMUSG00000010048

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 31 340 7.3e-101 PFAM
Pfam:IFRD_C 385 438 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010195
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
AA Change: E87D

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112387
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000122985
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123005
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127380
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130053
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139581
AA Change: E87D

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334
AA Change: E87D

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144392
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149487
SMART Domains Protein: ENSMUSP00000117845
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 301 4.9e-103 PFAM
Pfam:Glyco_hydro_56 291 325 6.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194932
Predicted Effect probably benign
Transcript: ENSMUST00000195725
SMART Domains Protein: ENSMUSP00000141718
Gene: ENSMUSG00000010048

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 32 139 5.7e-28 PFAM
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Nat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Nat6 APN 9 107583599 missense probably benign 0.01
R1838:Nat6 UTSW 9 107583017 missense possibly damaging 0.49
R1839:Nat6 UTSW 9 107583017 missense possibly damaging 0.49
R2877:Nat6 UTSW 9 107583168 missense possibly damaging 0.85
R3688:Nat6 UTSW 9 107583350 missense possibly damaging 0.83
R4836:Nat6 UTSW 9 107583539 missense probably damaging 1.00
R4873:Nat6 UTSW 9 107583619 missense probably damaging 0.97
R4875:Nat6 UTSW 9 107583619 missense probably damaging 0.97
R6029:Nat6 UTSW 9 107583554 missense probably damaging 1.00
R6893:Nat6 UTSW 9 107583026 missense probably damaging 0.96
R7278:Nat6 UTSW 9 107583299 missense probably damaging 1.00
R7294:Nat6 UTSW 9 107582983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGATTCAACCTGTCCAAGCTAAC -3'
(R):5'- GGTCTAGTACCCGTGATAAGC -3'

Sequencing Primer
(F):5'- GTCCAAGCTAACCCTGGATCCTG -3'
(R):5'- CCGTGATAAGCGGGCATG -3'
Posted On2015-01-23