Incidental Mutation 'R2878:Ulk4'
ID260181
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 040466-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121260039 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000129214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably benign
Transcript: ENSMUST00000051479
AA Change: D258G

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: D258G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably benign
Transcript: ENSMUST00000171061
AA Change: D258G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: D258G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
AA Change: D258G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: D258G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCATGCAGTGAAATCCTC -3'
(R):5'- AGGCTGTGACGTGGCTAAAG -3'

Sequencing Primer
(F):5'- TGCAGTGAAATCCTCATCGAG -3'
(R):5'- GGCTAAAGGGCCCAGTG -3'
Posted On2015-01-23