Incidental Mutation 'R2878:Fscb'
ID260186
Institutional Source Beutler Lab
Gene Symbol Fscb
Ensembl Gene ENSMUSG00000043060
Gene Namefibrous sheath CABYR binding protein
SynonymsEG623046
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location64471330-64474690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64472574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 706 (V706E)
Ref Sequence ENSEMBL: ENSMUSP00000051554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059833]
Predicted Effect unknown
Transcript: ENSMUST00000059833
AA Change: V706E
SMART Domains Protein: ENSMUSP00000051554
Gene: ENSMUSG00000043060
AA Change: V706E

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
internal_repeat_1 295 465 2.4e-7 PROSPERO
low complexity region 483 501 N/A INTRINSIC
low complexity region 510 547 N/A INTRINSIC
low complexity region 558 595 N/A INTRINSIC
low complexity region 599 622 N/A INTRINSIC
low complexity region 641 661 N/A INTRINSIC
low complexity region 673 708 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
internal_repeat_1 736 895 2.4e-7 PROSPERO
internal_repeat_2 751 871 6.17e-6 PROSPERO
low complexity region 899 916 N/A INTRINSIC
internal_repeat_2 919 1046 6.17e-6 PROSPERO
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Fscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fscb APN 12 64473381 missense possibly damaging 0.46
IGL01099:Fscb APN 12 64472101 missense unknown
IGL01394:Fscb APN 12 64473804 missense possibly damaging 0.83
IGL02570:Fscb APN 12 64472178 missense unknown
IGL02974:Fscb APN 12 64471525 missense unknown
IGL03150:Fscb APN 12 64472430 missense unknown
IGL03407:Fscb APN 12 64473495 missense probably damaging 0.96
FR4548:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472565 missense unknown
R0056:Fscb UTSW 12 64474247 missense possibly damaging 0.66
R0490:Fscb UTSW 12 64472887 missense unknown
R0492:Fscb UTSW 12 64473518 missense possibly damaging 0.46
R0702:Fscb UTSW 12 64472001 missense unknown
R1017:Fscb UTSW 12 64473468 missense probably benign 0.07
R1672:Fscb UTSW 12 64471518 missense unknown
R1737:Fscb UTSW 12 64474581 missense possibly damaging 0.83
R1795:Fscb UTSW 12 64474401 missense probably damaging 0.99
R1969:Fscb UTSW 12 64473234 missense unknown
R1984:Fscb UTSW 12 64474683 missense unknown
R2164:Fscb UTSW 12 64473793 missense probably damaging 0.96
R2213:Fscb UTSW 12 64474116 missense possibly damaging 0.84
R2874:Fscb UTSW 12 64473436 missense probably benign 0.00
R3873:Fscb UTSW 12 64473132 missense unknown
R4734:Fscb UTSW 12 64474470 missense possibly damaging 0.82
R4773:Fscb UTSW 12 64473690 missense probably damaging 1.00
R4940:Fscb UTSW 12 64473814 missense probably benign 0.03
R4981:Fscb UTSW 12 64473619 missense possibly damaging 0.46
R5105:Fscb UTSW 12 64473336 missense possibly damaging 0.82
R5845:Fscb UTSW 12 64472784 missense unknown
R6049:Fscb UTSW 12 64474320 missense possibly damaging 0.66
R6743:Fscb UTSW 12 64471573 missense unknown
R7026:Fscb UTSW 12 64471617 missense unknown
R7285:Fscb UTSW 12 64471549 missense unknown
R7372:Fscb UTSW 12 64471824 missense unknown
R7400:Fscb UTSW 12 64471617 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTGTGCAGAGGCTTCTTCAG -3'
(R):5'- GGCTCTGCTGAAGTTTCTCC -3'

Sequencing Primer
(F):5'- TTCAGCAGTGGACTCACCTGATAAAG -3'
(R):5'- GTTTCTCCTCCACAAACTGAAGAGG -3'
Posted On2015-01-23