Incidental Mutation 'R2878:Eml4'
ID260203
Institutional Source Beutler Lab
Gene Symbol Eml4
Ensembl Gene ENSMUSG00000032624
Gene Nameechinoderm microtubule associated protein like 4
Synonyms4930443C24Rik
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R2878 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83350931-83480361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83410174 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 58 (H58Q)
Ref Sequence ENSEMBL: ENSMUSP00000041880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]
Predicted Effect probably benign
Transcript: ENSMUST00000049503
AA Change: H58Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624
AA Change: H58Q

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 197 246 1.79e-1 SMART
Blast:WD40 252 294 3e-19 BLAST
WD40 297 336 5.97e-1 SMART
WD40 345 382 2.96e1 SMART
low complexity region 388 396 N/A INTRINSIC
WD40 397 436 1.48e-2 SMART
WD40 480 519 4.95e-4 SMART
WD40 522 560 7.92e1 SMART
WD40 563 602 5.75e-1 SMART
WD40 609 648 2.69e-5 SMART
WD40 722 762 8.04e-4 SMART
low complexity region 793 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096766
AA Change: H58Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: H58Q

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
low complexity region 137 155 N/A INTRINSIC
Pfam:HELP 236 308 1.1e-33 PFAM
WD40 309 358 1.79e-1 SMART
Blast:WD40 364 406 4e-20 BLAST
WD40 409 448 5.97e-1 SMART
WD40 457 494 2.96e1 SMART
low complexity region 500 508 N/A INTRINSIC
WD40 509 548 1.48e-2 SMART
WD40 592 631 4.95e-4 SMART
WD40 634 672 7.92e1 SMART
WD40 675 714 5.75e-1 SMART
WD40 721 760 2.69e-5 SMART
WD40 834 874 8.04e-4 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112363
AA Change: H58Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624
AA Change: H58Q

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 240 289 1.79e-1 SMART
Blast:WD40 295 337 3e-19 BLAST
WD40 340 379 5.97e-1 SMART
WD40 388 425 2.96e1 SMART
low complexity region 431 439 N/A INTRINSIC
WD40 440 479 1.48e-2 SMART
WD40 523 562 4.95e-4 SMART
WD40 565 603 7.92e1 SMART
WD40 606 645 5.75e-1 SMART
WD40 652 691 2.69e-5 SMART
WD40 765 805 8.04e-4 SMART
low complexity region 836 848 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Wdr45 C T X: 7,727,372 P271S probably damaging Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Eml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Eml4 APN 17 83448184 missense probably benign 0.05
IGL00815:Eml4 APN 17 83450790 splice site probably benign
IGL01969:Eml4 APN 17 83445980 missense possibly damaging 0.95
IGL02005:Eml4 APN 17 83477703 splice site probably benign
IGL02273:Eml4 APN 17 83456379 splice site probably null
IGL02318:Eml4 APN 17 83441366 missense probably benign 0.01
IGL02421:Eml4 APN 17 83477892 missense probably benign 0.00
IGL02728:Eml4 APN 17 83473139 splice site probably null
IGL02814:Eml4 APN 17 83441362 nonsense probably null
IGL02900:Eml4 APN 17 83477992 missense probably benign 0.00
IGL03205:Eml4 APN 17 83454444 missense probably damaging 1.00
erring UTSW 17 83448217 missense probably damaging 1.00
R0147:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0148:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0440:Eml4 UTSW 17 83446058 critical splice donor site probably null
R0541:Eml4 UTSW 17 83440042 missense probably benign 0.00
R0645:Eml4 UTSW 17 83463493 splice site probably benign
R0733:Eml4 UTSW 17 83454464 missense possibly damaging 0.88
R0944:Eml4 UTSW 17 83478060 missense probably benign 0.08
R1071:Eml4 UTSW 17 83478039 nonsense probably null
R1975:Eml4 UTSW 17 83410193 missense probably benign 0.00
R2042:Eml4 UTSW 17 83448178 missense probably damaging 0.97
R2229:Eml4 UTSW 17 83451056 missense probably benign 0.05
R2257:Eml4 UTSW 17 83477760 missense probably damaging 0.99
R3820:Eml4 UTSW 17 83473065 missense probably damaging 1.00
R4466:Eml4 UTSW 17 83421674 nonsense probably null
R4620:Eml4 UTSW 17 83461533 missense probably benign 0.13
R4657:Eml4 UTSW 17 83450948 nonsense probably null
R4717:Eml4 UTSW 17 83448225 missense probably benign 0.38
R4740:Eml4 UTSW 17 83410030 missense probably damaging 1.00
R5073:Eml4 UTSW 17 83463577 missense probably damaging 1.00
R5699:Eml4 UTSW 17 83410085 missense probably benign 0.16
R5834:Eml4 UTSW 17 83477741 missense probably damaging 1.00
R5944:Eml4 UTSW 17 83446043 missense possibly damaging 0.52
R6044:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R6378:Eml4 UTSW 17 83448217 missense probably damaging 1.00
R6980:Eml4 UTSW 17 83451017 missense probably benign 0.00
R7025:Eml4 UTSW 17 83425311 missense probably benign 0.04
R7037:Eml4 UTSW 17 83425327 missense probably benign 0.04
R7042:Eml4 UTSW 17 83461570 missense probably damaging 0.99
R7192:Eml4 UTSW 17 83454461 missense probably benign 0.01
R7525:Eml4 UTSW 17 83445950 missense not run
R7548:Eml4 UTSW 17 83425337 missense not run
Predicted Primers PCR Primer
(F):5'- GGTGTAATTTTCTCACCAGAAGG -3'
(R):5'- CTAAGCCTGTAAGGGATGTCAGTG -3'

Sequencing Primer
(F):5'- GGAAATTCTTTCTTGAACAGTCTGG -3'
(R):5'- ATGTCAGTGCTGTCACACAGG -3'
Posted On2015-01-23