Incidental Mutation 'R2878:Wdr45'
ID260209
Institutional Source Beutler Lab
Gene Symbol Wdr45
Ensembl Gene ENSMUSG00000039382
Gene NameWD repeat domain 45
SynonymsC79260, DXImx38e, Sfc19, Wdrx1, JM5
MMRRC Submission 040466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2878 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location7714333-7728206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7727372 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 271 (P271S)
Ref Sequence ENSEMBL: ENSMUSP00000111352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033489] [ENSMUST00000033490] [ENSMUST00000043045] [ENSMUST00000115687] [ENSMUST00000115688] [ENSMUST00000115689] [ENSMUST00000116633] [ENSMUST00000116634] [ENSMUST00000125991] [ENSMUST00000131077] [ENSMUST00000144148] [ENSMUST00000148624] [ENSMUST00000154253] [ENSMUST00000156000] [ENSMUST00000207337] [ENSMUST00000207386] [ENSMUST00000207461] [ENSMUST00000207541] [ENSMUST00000207589] [ENSMUST00000207675] [ENSMUST00000208072] [ENSMUST00000208156] [ENSMUST00000208443] [ENSMUST00000208524] [ENSMUST00000208528] [ENSMUST00000208553] [ENSMUST00000208618] [ENSMUST00000208719] [ENSMUST00000208996] [ENSMUST00000209143] [ENSMUST00000209144]
Predicted Effect probably benign
Transcript: ENSMUST00000033489
SMART Domains Protein: ENSMUSP00000033489
Gene: ENSMUSG00000031149

DomainStartEndE-ValueType
Pfam:PRA1 1 157 4.2e-41 PFAM
low complexity region 164 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033490
SMART Domains Protein: ENSMUSP00000033490
Gene: ENSMUSG00000031150

DomainStartEndE-ValueType
Pfam:DUF3338 1 142 5.1e-50 PFAM
low complexity region 154 165 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043045
AA Change: P285S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041456
Gene: ENSMUSG00000039382
AA Change: P285S

DomainStartEndE-ValueType
Blast:WD40 1 33 3e-15 BLAST
Blast:WD40 33 83 2e-18 BLAST
WD40 92 127 2.37e2 SMART
WD40 181 221 2.44e-3 SMART
WD40 224 265 4.79e-1 SMART
Blast:WD40 293 336 4e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000115687
AA Change: P285S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111351
Gene: ENSMUSG00000039382
AA Change: P285S

DomainStartEndE-ValueType
Blast:WD40 1 33 3e-15 BLAST
Blast:WD40 33 83 2e-18 BLAST
WD40 92 127 2.37e2 SMART
WD40 181 221 2.44e-3 SMART
WD40 224 265 4.79e-1 SMART
Blast:WD40 293 336 4e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000115688
AA Change: P271S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111352
Gene: ENSMUSG00000039382
AA Change: P271S

DomainStartEndE-ValueType
Blast:WD40 1 33 2e-15 BLAST
Blast:WD40 33 83 1e-18 BLAST
WD40 92 127 2.37e2 SMART
WD40 181 221 2.44e-3 SMART
Blast:WD40 224 251 7e-8 BLAST
Blast:WD40 279 322 2e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000115689
AA Change: P285S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111353
Gene: ENSMUSG00000039382
AA Change: P285S

DomainStartEndE-ValueType
Blast:WD40 1 33 3e-15 BLAST
Blast:WD40 33 83 2e-18 BLAST
WD40 92 127 2.37e2 SMART
WD40 181 221 2.44e-3 SMART
WD40 224 265 4.79e-1 SMART
Blast:WD40 293 336 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000116633
SMART Domains Protein: ENSMUSP00000112332
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 1e-15 BLAST
Blast:WD40 33 83 1e-17 BLAST
WD40 92 127 2.37e2 SMART
WD40 181 221 2.44e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116634
AA Change: P250S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112333
Gene: ENSMUSG00000039382
AA Change: P250S

DomainStartEndE-ValueType
Blast:WD40 1 33 4e-15 BLAST
WD40 57 92 2.37e2 SMART
WD40 146 186 2.44e-3 SMART
WD40 189 230 4.79e-1 SMART
Blast:WD40 258 301 7e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124707
Predicted Effect probably benign
Transcript: ENSMUST00000125991
SMART Domains Protein: ENSMUSP00000119766
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 2e-17 BLAST
SCOP:d1k32a2 8 54 9e-3 SMART
PDB:3VU4|B 9 68 1e-7 PDB
Blast:WD40 33 78 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127847
Predicted Effect probably benign
Transcript: ENSMUST00000131077
SMART Domains Protein: ENSMUSP00000117784
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 7e-18 BLAST
PDB:3VU4|B 9 135 4e-9 PDB
Blast:WD40 33 83 5e-19 BLAST
Blast:WD40 92 127 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000144148
SMART Domains Protein: ENSMUSP00000116483
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 1e-17 BLAST
PDB:3VU4|B 9 95 5e-9 PDB
Blast:WD40 33 83 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148624
SMART Domains Protein: ENSMUSP00000122086
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 7e-18 BLAST
PDB:3VU4|B 9 135 4e-9 PDB
Blast:WD40 33 83 5e-19 BLAST
Blast:WD40 92 127 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154253
SMART Domains Protein: ENSMUSP00000138122
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 2e-17 BLAST
PDB:3VU4|B 9 68 1e-7 PDB
Blast:WD40 33 80 3e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155914
Predicted Effect probably benign
Transcript: ENSMUST00000156000
SMART Domains Protein: ENSMUSP00000121634
Gene: ENSMUSG00000039382

DomainStartEndE-ValueType
Blast:WD40 1 33 7e-18 BLAST
PDB:3VU4|B 9 135 4e-9 PDB
Blast:WD40 33 83 5e-19 BLAST
Blast:WD40 92 127 1e-16 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000207109
AA Change: P211S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207183
Predicted Effect probably benign
Transcript: ENSMUST00000207337
Predicted Effect possibly damaging
Transcript: ENSMUST00000207386
AA Change: P183S

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000207461
AA Change: P78S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000207541
Predicted Effect probably benign
Transcript: ENSMUST00000207589
AA Change: P285S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000207675
AA Change: P218S

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000208072
Predicted Effect probably benign
Transcript: ENSMUST00000208156
Predicted Effect probably damaging
Transcript: ENSMUST00000208443
AA Change: P214S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208517
Predicted Effect probably benign
Transcript: ENSMUST00000208524
Predicted Effect probably benign
Transcript: ENSMUST00000208528
Predicted Effect probably benign
Transcript: ENSMUST00000208553
Predicted Effect probably damaging
Transcript: ENSMUST00000208618
AA Change: P246S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208918
Predicted Effect probably benign
Transcript: ENSMUST00000208996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209077
Predicted Effect probably benign
Transcript: ENSMUST00000209143
Predicted Effect probably benign
Transcript: ENSMUST00000209144
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene has a pseudogene at chromosome 4q31.3. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity and full-length nature of some variants have not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,291,889 L1251F possibly damaging Het
Accsl A T 2: 93,859,410 M384K probably damaging Het
Adgrg7 A G 16: 56,750,454 F404L probably benign Het
Akr1c20 G A 13: 4,507,775 T251M probably damaging Het
Amph G A 13: 19,104,267 V309I possibly damaging Het
Ano2 T G 6: 125,863,518 F384C probably damaging Het
Aplf G A 6: 87,668,427 R32* probably null Het
Arhgef18 A G 8: 3,432,759 M155V probably benign Het
Atg2b A T 12: 105,664,009 Y374* probably null Het
Camkmt T C 17: 85,431,551 probably benign Het
Capn2 T A 1: 182,517,233 E41V probably benign Het
Cd53 T C 3: 106,767,416 T112A probably benign Het
Cyp2a4 G A 7: 26,312,187 E278K possibly damaging Het
Dact2 A T 17: 14,195,914 S675T probably damaging Het
Dync1li2 A C 8: 104,429,415 Y265D probably damaging Het
Eml4 T A 17: 83,410,174 H58Q probably benign Het
F13b T C 1: 139,501,747 M1T probably null Het
Fam83b A G 9: 76,490,810 F1004L probably damaging Het
Fbxo48 A G 11: 16,953,382 K3E possibly damaging Het
Fbxw13 A G 9: 109,181,466 F368S probably damaging Het
Fbxw19 A T 9: 109,485,970 W175R probably damaging Het
Fibcd1 G A 2: 31,838,666 P60S probably benign Het
Fscb A T 12: 64,472,574 V706E unknown Het
Gfm2 A G 13: 97,153,249 R181G possibly damaging Het
Gm17546 A T 15: 95,829,924 probably benign Het
Gm4778 G T 3: 94,266,480 C265F possibly damaging Het
Grin1 A G 2: 25,297,629 V594A probably damaging Het
Itpripl1 A G 2: 127,141,614 V196A probably benign Het
Kcns1 A G 2: 164,164,762 I427T probably damaging Het
Map3k19 T A 1: 127,823,793 E607V possibly damaging Het
Map3k4 T C 17: 12,264,067 S588G probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nat6 A T 9: 107,583,168 E87D possibly damaging Het
Nebl C A 2: 17,434,929 D178Y probably damaging Het
Nfatc3 C A 8: 106,092,144 T498K probably damaging Het
Nfkb2 G A 19: 46,307,441 R158H possibly damaging Het
Obscn T C 11: 59,056,188 E4337G possibly damaging Het
Olfr1459 A G 19: 13,146,407 L84P probably benign Het
Palb2 A G 7: 122,114,429 V877A probably damaging Het
Rbm6 T C 9: 107,852,450 E333G probably damaging Het
Rem2 A G 14: 54,476,362 T31A possibly damaging Het
Ric1 A G 19: 29,602,330 D1224G possibly damaging Het
Rp1 A G 1: 4,348,139 S917P probably damaging Het
Scn2a G A 2: 65,688,371 G363D probably damaging Het
Shcbp1l A T 1: 153,437,518 probably benign Het
Skor2 G T 18: 76,860,724 E714* probably null Het
Slc15a1 T A 14: 121,465,933 K545N probably benign Het
Slc1a2 T A 2: 102,761,167 M414K probably damaging Het
Slc7a8 A G 14: 54,759,686 S70P probably damaging Het
Taf1a A G 1: 183,397,835 E117G probably damaging Het
Trem2 A G 17: 48,351,113 D135G probably benign Het
Ttn T C 2: 76,737,065 D27828G probably damaging Het
Ulk4 T C 9: 121,260,039 D258G probably benign Het
Unc80 TGTATTCCAGGCG TG 1: 66,671,576 probably benign Het
Vmn2r56 A C 7: 12,711,027 M433R probably benign Het
Zfp410 A C 12: 84,331,637 N245T probably damaging Het
Other mutations in Wdr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02453:Wdr45 APN X 7727281 unclassified probably null
IGL02643:Wdr45 APN X 7727049 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCTTCCAGTGACAAGGG -3'
(R):5'- AATGGCATCATGTTCCAGTTTC -3'

Sequencing Primer
(F):5'- TTCCAGTGACAAGGGCACTGTC -3'
(R):5'- CTGATAGCCCTTAAATTCTTTTAGGG -3'
Posted On2015-01-23