Incidental Mutation 'R2879:Abca17'
ID260257
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 040467-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R2879 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 24289507 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 1018 (T1018R)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: T1018R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: T1018R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: T1018R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: T1018R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 3,976,353 probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Arhgef10l G T 4: 140,515,287 H890Q probably benign Het
Ccnj T A 19: 40,844,714 L112Q probably damaging Het
Chaf1a T C 17: 56,044,114 probably null Het
Chchd4 A G 6: 91,465,218 S73P probably damaging Het
Chd3 T C 11: 69,364,098 K139E possibly damaging Het
Cyp2b13 T G 7: 26,086,031 probably null Het
Dagla T C 19: 10,271,084 I71V possibly damaging Het
Epor A T 9: 21,959,640 W315R probably damaging Het
Etv1 T A 12: 38,783,810 probably null Het
Fbn2 A T 18: 58,069,242 C1280S probably damaging Het
Fbxo2 G C 4: 148,166,011 R269P probably damaging Het
Fer1l4 A T 2: 156,052,200 L61Q probably damaging Het
Ggnbp2 C T 11: 84,832,971 probably null Het
Gm498 T A 7: 143,894,063 Y214* probably null Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ibsp G A 5: 104,310,394 E266K possibly damaging Het
Lamb3 T A 1: 193,330,784 M439K possibly damaging Het
Lnx1 C T 5: 74,620,123 V246M probably benign Het
Lrrc32 A G 7: 98,499,777 Q588R probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Med13 C T 11: 86,299,162 A974T possibly damaging Het
Mogat2 A T 7: 99,222,366 I246N possibly damaging Het
Myl2 T C 5: 122,104,685 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr406 T A 11: 74,270,223 V278D probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pik3r2 A G 8: 70,772,385 Y145H probably benign Het
Plg A G 17: 12,404,100 E509G possibly damaging Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ros1 C T 10: 52,172,840 probably null Het
Sbno1 A G 5: 124,388,572 M960T probably damaging Het
Smad1 T C 8: 79,353,455 probably null Het
Ssc5d G A 7: 4,936,907 probably null Het
Tfcp2 C T 15: 100,551,320 probably null Het
Tmem121 A G 12: 113,188,408 Y82C probably damaging Het
Tmem131 T C 1: 36,841,707 I161V possibly damaging Het
Tpp2 T A 1: 43,971,623 F523L probably damaging Het
Ttn C T 2: 76,771,505 silent Het
Ttpal A G 2: 163,615,583 probably null Het
Vdr T A 15: 97,859,127 Y288F probably benign Het
Wipf2 C T 11: 98,892,654 A302V probably benign Het
Zfp346 T G 13: 55,105,350 C3G possibly damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGAAAGCAACTGTGACTAGC -3'
(R):5'- AGTGTACTGTGTGCCACTGG -3'

Sequencing Primer
(F):5'- GAAAGGCAGTCTCACGCACTG -3'
(R):5'- ACTGGGCCTGGTGCGATG -3'
Posted On2015-01-23