Incidental Mutation 'R2880:Brinp3'
ID 260265
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Name bone morphogenetic protein/retinoic acid inducible neural specific 3
Synonyms Fam5c, B830045N13Rik
MMRRC Submission 040468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R2880 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 146371367-146778210 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 146777740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 729 (R729H)
Ref Sequence ENSEMBL: ENSMUSP00000126074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]
AlphaFold Q499E0
Predicted Effect probably damaging
Transcript: ENSMUST00000074622
AA Change: R729H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: R729H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166814
AA Change: R729H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: R729H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 88,948,661 (GRCm39) E150K probably damaging Het
Blnk T C 19: 40,950,899 (GRCm39) Y84C probably damaging Het
Bsn C T 9: 107,990,266 (GRCm39) A1829T possibly damaging Het
Cd300c A T 11: 114,850,616 (GRCm39) N62K probably benign Het
Chd3 T C 11: 69,242,946 (GRCm39) D1425G probably damaging Het
Ewsr1 C A 11: 5,028,523 (GRCm39) probably benign Het
Gm4076 G A 13: 85,275,357 (GRCm39) noncoding transcript Het
Gm9637 A G 14: 19,401,978 (GRCm38) noncoding transcript Het
Greb1l A T 18: 10,547,288 (GRCm39) N1502I possibly damaging Het
H13 A G 2: 152,537,481 (GRCm39) M309V probably damaging Het
Lmf2 A G 15: 89,235,856 (GRCm39) S683P possibly damaging Het
Lrit1 T A 14: 36,779,394 (GRCm39) L109Q probably damaging Het
Maml2 A T 9: 13,531,893 (GRCm39) probably null Het
Map3k14 C A 11: 103,111,858 (GRCm39) R941L probably damaging Het
Megf6 A G 4: 154,337,006 (GRCm39) K262E probably damaging Het
Mtnr1b T G 9: 15,774,102 (GRCm39) Y319S probably damaging Het
Myh8 A G 11: 67,188,090 (GRCm39) K954R probably damaging Het
Myof T C 19: 37,911,473 (GRCm39) D1486G probably benign Het
Nbea A G 3: 55,554,779 (GRCm39) V2623A probably benign Het
Pak1 T A 7: 97,554,018 (GRCm39) Y463N probably damaging Het
Pex5l T A 3: 33,047,152 (GRCm39) probably null Het
Rasa4 T C 5: 136,120,625 (GRCm39) V87A probably damaging Het
Rnf112 G A 11: 61,341,293 (GRCm39) H431Y possibly damaging Het
Slc25a30 A G 14: 76,007,651 (GRCm39) V118A probably benign Het
Slc4a7 T A 14: 14,773,277 (GRCm38) I872K probably damaging Het
Slc5a11 GGTGC G 7: 122,838,595 (GRCm39) probably null Het
Sycp1 T C 3: 102,726,214 (GRCm39) E970G probably damaging Het
Tex15 T A 8: 34,064,935 (GRCm39) L1455* probably null Het
Tgfb2 T A 1: 186,436,752 (GRCm39) T74S probably damaging Het
Vmn2r65 A T 7: 84,613,094 (GRCm39) C42S probably damaging Het
Zbtb12 T A 17: 35,114,455 (GRCm39) I80N probably damaging Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146,777,512 (GRCm39) missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146,776,905 (GRCm39) missense probably benign
IGL01702:Brinp3 APN 1 146,627,735 (GRCm39) splice site probably benign
IGL01728:Brinp3 APN 1 146,707,289 (GRCm39) splice site probably null
IGL01733:Brinp3 APN 1 146,390,541 (GRCm39) missense probably benign 0.33
IGL01937:Brinp3 APN 1 146,776,878 (GRCm39) missense probably benign
IGL02020:Brinp3 APN 1 146,777,865 (GRCm39) utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146,627,600 (GRCm39) missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146,776,860 (GRCm39) missense probably benign 0.00
IGL02366:Brinp3 APN 1 146,577,481 (GRCm39) missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146,777,770 (GRCm39) missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146,577,587 (GRCm39) splice site probably null
IGL03099:Brinp3 APN 1 146,777,835 (GRCm39) missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146,777,161 (GRCm39) missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146,777,161 (GRCm39) missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146,777,189 (GRCm39) missense probably benign 0.04
R0021:Brinp3 UTSW 1 146,777,189 (GRCm39) missense probably benign 0.04
R0266:Brinp3 UTSW 1 146,558,418 (GRCm39) nonsense probably null
R1468:Brinp3 UTSW 1 146,777,700 (GRCm39) missense probably benign 0.01
R1468:Brinp3 UTSW 1 146,777,700 (GRCm39) missense probably benign 0.01
R1522:Brinp3 UTSW 1 146,777,628 (GRCm39) missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146,390,520 (GRCm39) missense probably benign
R1898:Brinp3 UTSW 1 146,776,987 (GRCm39) missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146,577,579 (GRCm39) missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146,777,658 (GRCm39) nonsense probably null
R2272:Brinp3 UTSW 1 146,777,142 (GRCm39) missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146,776,812 (GRCm39) missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146,577,492 (GRCm39) missense probably benign
R3918:Brinp3 UTSW 1 146,627,599 (GRCm39) missense probably damaging 0.99
R3939:Brinp3 UTSW 1 146,627,599 (GRCm39) missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146,627,599 (GRCm39) missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146,627,599 (GRCm39) missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146,627,599 (GRCm39) missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146,777,430 (GRCm39) missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146,603,378 (GRCm39) intron probably benign
R5009:Brinp3 UTSW 1 146,776,787 (GRCm39) missense probably benign 0.25
R5034:Brinp3 UTSW 1 146,603,458 (GRCm39) intron probably benign
R5166:Brinp3 UTSW 1 146,777,105 (GRCm39) missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146,707,464 (GRCm39) missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146,777,197 (GRCm39) missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146,577,537 (GRCm39) missense probably benign 0.01
R5681:Brinp3 UTSW 1 146,777,484 (GRCm39) missense probably benign 0.12
R6351:Brinp3 UTSW 1 146,777,323 (GRCm39) missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146,777,644 (GRCm39) missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146,777,431 (GRCm39) missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146,390,627 (GRCm39) nonsense probably null
R7223:Brinp3 UTSW 1 146,776,812 (GRCm39) missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146,558,426 (GRCm39) nonsense probably null
R7347:Brinp3 UTSW 1 146,777,824 (GRCm39) missense probably benign 0.22
R7375:Brinp3 UTSW 1 146,777,748 (GRCm39) missense possibly damaging 0.91
R7412:Brinp3 UTSW 1 146,777,748 (GRCm39) missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146,777,139 (GRCm39) missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146,777,748 (GRCm39) missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146,777,301 (GRCm39) missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146,577,409 (GRCm39) missense probably damaging 1.00
R7737:Brinp3 UTSW 1 146,558,332 (GRCm39) missense probably damaging 0.98
R7793:Brinp3 UTSW 1 146,622,306 (GRCm39) missense probably benign 0.20
R8334:Brinp3 UTSW 1 146,777,791 (GRCm39) missense probably damaging 0.99
R8401:Brinp3 UTSW 1 146,777,184 (GRCm39) missense probably benign 0.17
R9205:Brinp3 UTSW 1 146,777,827 (GRCm39) missense possibly damaging 0.57
R9328:Brinp3 UTSW 1 146,707,455 (GRCm39) missense probably damaging 0.98
R9602:Brinp3 UTSW 1 146,622,234 (GRCm39) missense probably damaging 1.00
X0060:Brinp3 UTSW 1 146,777,524 (GRCm39) missense probably benign 0.01
Z1176:Brinp3 UTSW 1 146,777,814 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACTTTGACCCTGAAGCC -3'
(R):5'- GCCATCCAACGTTATTGACTG -3'

Sequencing Primer
(F):5'- TTGACCCTGAAGCCATTCGG -3'
(R):5'- TCCAACGTTATTGACTGATATAAGAC -3'
Posted On 2015-01-23