Incidental Mutation 'R2880:Pak1'
ID260278
Institutional Source Beutler Lab
Gene Symbol Pak1
Ensembl Gene ENSMUSG00000030774
Gene Namep21 (RAC1) activated kinase 1
SynonymsPaka, PAK-1
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2880 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location97788541-97912381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97904811 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 463 (Y463N)
Ref Sequence ENSEMBL: ENSMUSP00000146055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033040] [ENSMUST00000156637] [ENSMUST00000206984]
Predicted Effect probably damaging
Transcript: ENSMUST00000033040
AA Change: Y463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033040
Gene: ENSMUSG00000030774
AA Change: Y463N

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
low complexity region 168 191 N/A INTRINSIC
S_TKc 269 520 7.19e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156637
SMART Domains Protein: ENSMUSP00000138684
Gene: ENSMUSG00000030774

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206984
AA Change: Y463N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207017
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display defects in allergen-induced mast cell migration and degranulation. Mice homozygous for a different knock-out allele exhibit reduced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E150K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 probably benign Het
Gm4076 G A 13: 85,127,238 noncoding transcript Het
Gm9637 A G 14: 19,401,978 noncoding transcript Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 probably null Het
Map3k14 C A 11: 103,221,032 R941L probably damaging Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Pak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Pak1 APN 7 97854568 missense probably benign 0.03
IGL01676:Pak1 APN 7 97883531 missense probably benign 0.00
IGL02058:Pak1 APN 7 97911115 missense probably damaging 1.00
IGL02557:Pak1 APN 7 97871587 missense probably benign 0.08
IGL02678:Pak1 APN 7 97894002 missense probably damaging 0.99
R1739:Pak1 UTSW 7 97904695 missense probably damaging 1.00
R1874:Pak1 UTSW 7 97871580 missense probably benign 0.23
R2057:Pak1 UTSW 7 97907797 splice site probably null
R2363:Pak1 UTSW 7 97886314 missense probably benign 0.01
R2420:Pak1 UTSW 7 97854479 missense probably benign 0.02
R3113:Pak1 UTSW 7 97866114 nonsense probably null
R3722:Pak1 UTSW 7 97854497 missense probably damaging 1.00
R4363:Pak1 UTSW 7 97883586 missense possibly damaging 0.49
R6021:Pak1 UTSW 7 97854463 missense probably damaging 1.00
R6459:Pak1 UTSW 7 97907881 missense probably benign 0.04
R6820:Pak1 UTSW 7 97886379 missense probably benign
R7336:Pak1 UTSW 7 97888972 missense probably benign 0.13
X0027:Pak1 UTSW 7 97904752 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCACTTACTGATGGAGTATCC -3'
(R):5'- AACTGGCAATCTTCTTATCCCAG -3'

Sequencing Primer
(F):5'- CACTTACTGATGGAGTATCCTAAGTG -3'
(R):5'- CCCAGTCTTGTAAGTCTAGGAGTAC -3'
Posted On2015-01-23