Incidental Mutation 'R2880:Map3k14'
ID260290
Institutional Source Beutler Lab
Gene Symbol Map3k14
Ensembl Gene ENSMUSG00000020941
Gene Namemitogen-activated protein kinase kinase kinase 14
SynonymsNik
MMRRC Submission 040468-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R2880 (G1)
Quality Score221
Status Not validated
Chromosome11
Chromosomal Location103219762-103267472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103221032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 941 (R941L)
Ref Sequence ENSEMBL: ENSMUSP00000021324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021324]
PDB Structure
Crystal structure of apo murine Nf-kappaB inducing kinase (NIK) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 6-alkynylindoline (cmp1) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 2-(aminothiazoly)phenol (cmp2) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) V408L bound to a 2-(aminothiazolyl)phenol (cmp3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021324
AA Change: R941L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021324
Gene: ENSMUSG00000020941
AA Change: R941L

DomainStartEndE-ValueType
low complexity region 134 153 N/A INTRINSIC
Pfam:Pkinase 402 653 2.1e-42 PFAM
Pfam:Pkinase_Tyr 402 653 1.5e-24 PFAM
low complexity region 706 719 N/A INTRINSIC
low complexity region 760 774 N/A INTRINSIC
low complexity region 789 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146163
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Homozygotes for a spontaneous mutation exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of lymph nodes and Peyer's patches, failure of isotype switching, and inflammation of exocrine organs.
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 89,112,799 E316K probably damaging Het
Blnk T C 19: 40,962,455 Y84C probably damaging Het
Brinp3 G A 1: 146,902,002 R729H probably damaging Het
Bsn C T 9: 108,113,067 A1829T possibly damaging Het
Cd300c A T 11: 114,959,790 N62K probably benign Het
Chd3 T C 11: 69,352,120 D1425G probably damaging Het
Ewsr1 C A 11: 5,078,523 V377L unknown Het
Gm4076 G A 13: 85,127,238 H93Y probably damaging Het
Gm9637 A G 14: 19,401,978 W208R probably benign Het
Greb1l A T 18: 10,547,288 N1502I possibly damaging Het
H13 A G 2: 152,695,561 M309V probably damaging Het
Lmf2 A G 15: 89,351,653 S683P possibly damaging Het
Lrit1 T A 14: 37,057,437 L109Q probably damaging Het
Maml2 A T 9: 13,620,597 Q203L noncoding transcript Het
Megf6 A G 4: 154,252,549 K262E probably damaging Het
Mtnr1b T G 9: 15,862,806 Y319S probably damaging Het
Myh8 A G 11: 67,297,264 K954R probably damaging Het
Myof T C 19: 37,923,025 D1486G probably benign Het
Nbea A G 3: 55,647,358 V2623A probably benign Het
Pak1 T A 7: 97,904,811 Y463N probably damaging Het
Pex5l T A 3: 32,993,003 probably null Het
Rasa4 T C 5: 136,091,771 V87A probably damaging Het
Rnf112 G A 11: 61,450,467 H431Y possibly damaging Het
Slc25a30 A G 14: 75,770,211 V118A probably benign Het
Slc4a7 T A 14: 14,773,277 I872K probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Sycp1 T C 3: 102,818,898 E970G probably damaging Het
Tex15 T A 8: 33,574,907 L1455* probably null Het
Tgfb2 T A 1: 186,704,555 T74S probably damaging Het
Vmn2r65 A T 7: 84,963,886 C42S probably damaging Het
Zbtb12 T A 17: 34,895,479 I80N probably damaging Het
Other mutations in Map3k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Map3k14 APN 11 103227579 missense probably damaging 1.00
IGL00590:Map3k14 APN 11 103237554 missense probably damaging 1.00
IGL03065:Map3k14 APN 11 103225101 missense probably damaging 1.00
lucky UTSW 11 103249558 nonsense
R0020:Map3k14 UTSW 11 103227674 missense probably damaging 0.99
R0070:Map3k14 UTSW 11 103239554 critical splice acceptor site probably null
R0294:Map3k14 UTSW 11 103227137 missense possibly damaging 0.80
R0624:Map3k14 UTSW 11 103242291 missense possibly damaging 0.77
R0734:Map3k14 UTSW 11 103227000 missense probably benign 0.00
R1015:Map3k14 UTSW 11 103225300 missense probably damaging 1.00
R1170:Map3k14 UTSW 11 103238917 splice site noncoding transcript
R1487:Map3k14 UTSW 11 103225337 missense possibly damaging 0.48
R2204:Map3k14 UTSW 11 103239454 missense possibly damaging 0.82
R4429:Map3k14 UTSW 11 103227584 missense probably damaging 1.00
R4624:Map3k14 UTSW 11 103231101 missense probably damaging 1.00
R4967:Map3k14 UTSW 11 103239531 missense probably benign 0.00
R5098:Map3k14 UTSW 11 103224359 missense probably damaging 1.00
R5148:Map3k14 UTSW 11 103239332 missense probably benign
R5208:Map3k14 UTSW 11 103239146 missense probably damaging 0.98
R5480:Map3k14 UTSW 11 103239504 missense probably benign 0.03
T0970:Map3k14 UTSW 11 103224298 nonsense probably null
X0023:Map3k14 UTSW 11 103239822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGGAGGTGCTTTACTC -3'
(R):5'- AAGCTCCCTTCTCGATGCATG -3'

Sequencing Primer
(F):5'- GGAGGTGCTTTACTCTGTTCCC -3'
(R):5'- TCACCCCAGCCGGTTTG -3'
Posted OnJan 23, 2015