Incidental Mutation 'R2873:Acvr1'
ID260380
Institutional Source Beutler Lab
Gene Symbol Acvr1
Ensembl Gene ENSMUSG00000026836
Gene Nameactivin A receptor, type 1
SynonymsAlk-2, ActR-I, Acvrlk2, SKR1, ALK2, Tsk7L, D330013D15Rik, Acvr, ActRIA, Alk8
MMRRC Submission 040461-MU
Accession Numbers

Genbank: NM_007394; MGI: 87911

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58388644-58567157 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 58477796 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 118 (Q118*)
Ref Sequence ENSEMBL: ENSMUSP00000120755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056376] [ENSMUST00000090935] [ENSMUST00000112599] [ENSMUST00000112601] [ENSMUST00000126407]
Predicted Effect probably null
Transcript: ENSMUST00000056376
AA Change: Q118*
SMART Domains Protein: ENSMUSP00000056784
Gene: ENSMUSG00000026836
AA Change: Q118*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000090935
AA Change: Q118*
SMART Domains Protein: ENSMUSP00000088453
Gene: ENSMUSG00000026836
AA Change: Q118*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112599
AA Change: Q118*
SMART Domains Protein: ENSMUSP00000108218
Gene: ENSMUSG00000026836
AA Change: Q118*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 1.4e-13 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112601
AA Change: Q118*
SMART Domains Protein: ENSMUSP00000108220
Gene: ENSMUSG00000026836
AA Change: Q118*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000126407
AA Change: Q118*
SMART Domains Protein: ENSMUSP00000120755
Gene: ENSMUSG00000026836
AA Change: Q118*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 3.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145495
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth arrest and complete embryonic lethality due to gastrulation defects associated with abnormalities in primitive streak formation, embryonic epiblast morphology, and mesoderm and ectoderm development. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Acvr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Acvr1 APN 2 58447573 missense probably benign 0.00
IGL01392:Acvr1 APN 2 58500546 missense probably benign 0.01
IGL01526:Acvr1 APN 2 58458985 missense probably benign 0.20
IGL02524:Acvr1 APN 2 58448307 splice site probably benign
IGL02682:Acvr1 APN 2 58477811 missense probably benign 0.00
IGL02795:Acvr1 APN 2 58462952 missense probably damaging 1.00
R0084:Acvr1 UTSW 2 58458883 critical splice donor site probably null
R0452:Acvr1 UTSW 2 58500495 missense probably benign 0.13
R0746:Acvr1 UTSW 2 58500550 start codon destroyed probably null 0.01
R1484:Acvr1 UTSW 2 58479889 missense probably damaging 1.00
R1514:Acvr1 UTSW 2 58447585 nonsense probably null
R1645:Acvr1 UTSW 2 58462899 missense probably damaging 1.00
R1925:Acvr1 UTSW 2 58447649 missense probably damaging 0.99
R2435:Acvr1 UTSW 2 58479692 missense probably damaging 1.00
R3729:Acvr1 UTSW 2 58462913 missense probably null 0.09
R3854:Acvr1 UTSW 2 58462934 missense probably damaging 1.00
R4438:Acvr1 UTSW 2 58477727 missense probably benign 0.00
R4863:Acvr1 UTSW 2 58477711 missense possibly damaging 0.60
R5543:Acvr1 UTSW 2 58463145 missense probably damaging 1.00
R5558:Acvr1 UTSW 2 58459017 missense probably damaging 1.00
R5618:Acvr1 UTSW 2 58462943 missense probably damaging 1.00
R6233:Acvr1 UTSW 2 58448399 missense probably benign 0.04
R6236:Acvr1 UTSW 2 58477666 missense probably benign 0.17
R6565:Acvr1 UTSW 2 58479757 missense probably damaging 1.00
R6912:Acvr1 UTSW 2 58447573 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAACTCACCGCTAGAGTG -3'
(R):5'- GATCACTTAAATGAGTGTCTGGGC -3'

Sequencing Primer
(F):5'- AGAGTGCTGTCTCCCACATTGG -3'
(R):5'- CACTTAAATGAGTGTCTGGGCCATTG -3'
Posted On2015-01-23