Incidental Mutation 'R2873:AI481877'
ID260388
Institutional Source Beutler Lab
Gene Symbol AI481877
Ensembl Gene ENSMUSG00000038598
Gene Nameexpressed sequence AI481877
SynonymsLOC242489, Gm426
MMRRC Submission 040461-MU
Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59043753-59138983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59093850 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 226 (L226R)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
Predicted Effect probably damaging
Transcript: ENSMUST00000107547
AA Change: L226R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: L226R

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122832
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in AI481877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:AI481877 APN 4 59086961 missense probably benign
IGL00574:AI481877 APN 4 59094201 missense possibly damaging 0.66
IGL01333:AI481877 APN 4 59047870 missense possibly damaging 0.66
IGL02282:AI481877 APN 4 59111114 missense unknown
IGL02418:AI481877 APN 4 59049075 splice site probably benign
IGL02621:AI481877 APN 4 59062668 missense probably damaging 0.97
IGL03028:AI481877 APN 4 59094274 missense possibly damaging 0.66
IGL03112:AI481877 APN 4 59049355 missense probably benign 0.27
IGL03137:AI481877 APN 4 59094162 missense probably benign 0.27
IGL03220:AI481877 APN 4 59082378 nonsense probably null
IGL03386:AI481877 APN 4 59069315 missense possibly damaging 0.66
1mM(1):AI481877 UTSW 4 59048024 nonsense probably null
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0194:AI481877 UTSW 4 59066534 splice site probably benign
R0366:AI481877 UTSW 4 59099410 missense probably benign 0.09
R0680:AI481877 UTSW 4 59043967 missense probably benign 0.00
R1419:AI481877 UTSW 4 59064457 missense possibly damaging 0.66
R1599:AI481877 UTSW 4 59072349 missense possibly damaging 0.82
R1699:AI481877 UTSW 4 59113926 missense unknown
R1799:AI481877 UTSW 4 59099383 missense possibly damaging 0.92
R1832:AI481877 UTSW 4 59066441 missense probably benign 0.05
R1870:AI481877 UTSW 4 59054142 splice site probably benign
R2076:AI481877 UTSW 4 59082410 missense possibly damaging 0.46
R2170:AI481877 UTSW 4 59069215 missense possibly damaging 0.92
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R3026:AI481877 UTSW 4 59062656 missense possibly damaging 0.83
R3079:AI481877 UTSW 4 59047848 missense possibly damaging 0.82
R3853:AI481877 UTSW 4 59047390 missense possibly damaging 0.66
R3914:AI481877 UTSW 4 59094201 missense possibly damaging 0.66
R4006:AI481877 UTSW 4 59076500 missense possibly damaging 0.53
R4364:AI481877 UTSW 4 59082294 missense possibly damaging 0.92
R4387:AI481877 UTSW 4 59060915 missense possibly damaging 0.66
R4454:AI481877 UTSW 4 59092383 missense possibly damaging 0.90
R4811:AI481877 UTSW 4 59082404 missense probably benign 0.19
R4853:AI481877 UTSW 4 59072345 missense possibly damaging 0.66
R4899:AI481877 UTSW 4 59062640 missense probably damaging 0.97
R5090:AI481877 UTSW 4 59111108 missense unknown
R5169:AI481877 UTSW 4 59059618 missense possibly damaging 0.66
R5297:AI481877 UTSW 4 59047543 missense probably benign
R5400:AI481877 UTSW 4 59082432 missense possibly damaging 0.83
R5419:AI481877 UTSW 4 59049017 missense probably benign 0.04
R5668:AI481877 UTSW 4 59047399 missense probably benign
R5770:AI481877 UTSW 4 59092466 missense probably benign 0.00
R5783:AI481877 UTSW 4 59076239 nonsense probably null
R5929:AI481877 UTSW 4 59092497 nonsense probably null
R6209:AI481877 UTSW 4 59043869 makesense probably null
R6230:AI481877 UTSW 4 59099345 missense probably benign
R6233:AI481877 UTSW 4 59076245 missense possibly damaging 0.92
R6351:AI481877 UTSW 4 59069317 missense probably benign 0.00
R6785:AI481877 UTSW 4 59049066 missense probably benign 0.01
R6884:AI481877 UTSW 4 59059652 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGATTCAACTTCAACCTCAGCTATG -3'
(R):5'- CCACAGGGTTAGATGCTGTTG -3'

Sequencing Primer
(F):5'- GCTATGGCTGAAACTCATTACTGAG -3'
(R):5'- GTGCTTCATCTCAACTTACACGAGAG -3'
Posted On2015-01-23