Incidental Mutation 'R2873:Atp13a2'
ID260392
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene NameATPase type 13A2
Synonyms
MMRRC Submission 040461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location140986873-141007330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141002983 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 773 (I773T)
Ref Sequence ENSEMBL: ENSMUSP00000126461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
Predicted Effect probably benign
Transcript: ENSMUST00000037055
AA Change: I690T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622
AA Change: I690T

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125797
Predicted Effect probably benign
Transcript: ENSMUST00000127833
AA Change: I690T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622
AA Change: I690T

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156995
Predicted Effect probably benign
Transcript: ENSMUST00000168047
AA Change: I773T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: I773T

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170797
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140992198 missense probably benign 0.02
IGL01476:Atp13a2 APN 4 141000770 missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 141006152 missense probably benign 0.00
IGL02257:Atp13a2 APN 4 141006089 missense probably benign 0.00
IGL02589:Atp13a2 APN 4 141006411 missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 141001949 missense probably benign 0.00
IGL03032:Atp13a2 APN 4 141000355 missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 141006173 missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 141000397 missense possibly damaging 0.69
calla UTSW 4 140994332 nonsense probably null
eastern_moon UTSW 4 141005016 missense probably damaging 0.99
yucca_brevifolia UTSW 4 140993802 missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 141006968 missense possibly damaging 0.83
PIT4469001:Atp13a2 UTSW 4 140994127 missense unknown
R0634:Atp13a2 UTSW 4 141006929 unclassified probably benign
R0881:Atp13a2 UTSW 4 141003931 missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 141002460 missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140994332 nonsense probably null
R1838:Atp13a2 UTSW 4 140994332 nonsense probably null
R1856:Atp13a2 UTSW 4 141004012 missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140996371 missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 141004261 missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140995391 missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2133:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 141003155 missense probably benign 0.00
R3025:Atp13a2 UTSW 4 140994348 missense probably damaging 1.00
R3939:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140992228 critical splice donor site probably null
R4357:Atp13a2 UTSW 4 141001904 missense probably benign 0.01
R4406:Atp13a2 UTSW 4 141006476 missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 141003276 critical splice donor site probably null
R5033:Atp13a2 UTSW 4 141000821 missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 141005138 missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 141000818 missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 141006070 missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 141004360 splice site probably null
R5614:Atp13a2 UTSW 4 140992182 missense probably benign 0.35
R5846:Atp13a2 UTSW 4 140995596 missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 141007056 missense probably benign 0.34
R6512:Atp13a2 UTSW 4 141003218 missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 141006984 missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140999151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGGTAGTGACATGGCCAG -3'
(R):5'- CCCTAGAGAATTAGCATCTCCGG -3'

Sequencing Primer
(F):5'- CTGAGGCCTACGTCAAAGG -3'
(R):5'- AATTAGCATCTCCGGGTCAG -3'
Posted On2015-01-23