Incidental Mutation 'R2873:Mdm1'
ID260420
Institutional Source Beutler Lab
Gene Symbol Mdm1
Ensembl Gene ENSMUSG00000020212
Gene Nametransformed mouse 3T3 cell double minute 1
SynonymsArrd2, Mdm-1
MMRRC Submission 040461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location118141811-118168997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118150942 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000132966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020437] [ENSMUST00000163238] [ENSMUST00000164077] [ENSMUST00000169817] [ENSMUST00000219087]
Predicted Effect probably benign
Transcript: ENSMUST00000020437
AA Change: T267A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020437
Gene: ENSMUSG00000020212
AA Change: T267A

DomainStartEndE-ValueType
Pfam:MDM1 9 544 1.1e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163238
AA Change: T267A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127919
Gene: ENSMUSG00000020212
AA Change: T267A

DomainStartEndE-ValueType
Pfam:MDM1 9 554 1.3e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164077
AA Change: T267A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132966
Gene: ENSMUSG00000020212
AA Change: T267A

DomainStartEndE-ValueType
Pfam:MDM1 9 544 5.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169817
AA Change: T222A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126258
Gene: ENSMUSG00000020212
AA Change: T222A

DomainStartEndE-ValueType
Pfam:MDM1 9 172 8.3e-55 PFAM
Pfam:MDM1 168 509 1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218400
Predicted Effect probably benign
Transcript: ENSMUST00000219087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219827
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein similar to the mouse double minute 1 protein. The mouse gene is located in double minute (DM) chromatin particles, is amplified in the mouse transformed 3T3 cell line, and the encoded protein is able to bind to p53. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a nonsense point mutation exhibit retinal degeneration, abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Mdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Mdm1 APN 10 118164441 missense probably damaging 1.00
IGL01400:Mdm1 APN 10 118157251 missense probably damaging 1.00
IGL01504:Mdm1 APN 10 118146600 missense probably damaging 1.00
IGL02070:Mdm1 APN 10 118146618 missense probably damaging 1.00
IGL02149:Mdm1 APN 10 118148065 missense probably damaging 1.00
IGL02817:Mdm1 APN 10 118164346 missense possibly damaging 0.66
IGL03076:Mdm1 APN 10 118159683 missense possibly damaging 0.95
PIT4696001:Mdm1 UTSW 10 118158540 missense probably benign
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0071:Mdm1 UTSW 10 118146796 missense probably damaging 1.00
R0166:Mdm1 UTSW 10 118166680 missense probably damaging 0.96
R0218:Mdm1 UTSW 10 118156878 splice site probably benign
R0446:Mdm1 UTSW 10 118152056 missense probably benign 0.01
R0605:Mdm1 UTSW 10 118146601 missense probably damaging 1.00
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R2870:Mdm1 UTSW 10 118150942 missense probably benign 0.02
R4816:Mdm1 UTSW 10 118146877 missense possibly damaging 0.82
R5571:Mdm1 UTSW 10 118159683 missense possibly damaging 0.95
R5623:Mdm1 UTSW 10 118150789 missense possibly damaging 0.66
R5806:Mdm1 UTSW 10 118166658 missense probably benign
R6537:Mdm1 UTSW 10 118158576 missense probably benign 0.00
R6539:Mdm1 UTSW 10 118150958 critical splice donor site probably null
R6891:Mdm1 UTSW 10 118148032 missense probably benign 0.04
R6952:Mdm1 UTSW 10 118168057 missense probably damaging 1.00
R7176:Mdm1 UTSW 10 118142865 missense probably damaging 1.00
Z1088:Mdm1 UTSW 10 118158362 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACCTAAGTTCTGTACCACTTAGTAACC -3'
(R):5'- TGTCCTCTCAGTCTACACAGG -3'

Sequencing Primer
(F):5'- TTAGTAACCAACCAAAAACGTAACTG -3'
(R):5'- TCTCAGTCTACACAGGACCTG -3'
Posted On2015-01-23