Incidental Mutation 'R2873:Olfr1510'
ID260428
Institutional Source Beutler Lab
Gene Symbol Olfr1510
Ensembl Gene ENSMUSG00000063106
Gene Nameolfactory receptor 1510
SynonymsGA_x6K02T2RJGY-583652-584608, MOR223-6
MMRRC Submission 040461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52409131-52414373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 52410861 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 4 (T4P)
Ref Sequence ENSEMBL: ENSMUSP00000150294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079459] [ENSMUST00000215928]
Predicted Effect probably benign
Transcript: ENSMUST00000079459
AA Change: T4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078424
Gene: ENSMUSG00000063106
AA Change: T4P

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 8.1e-50 PFAM
Pfam:7tm_1 45 293 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206257
AA Change: T4P
Predicted Effect probably benign
Transcript: ENSMUST00000215928
AA Change: T4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Ptger4 T C 15: 5,234,805 R457G probably benign Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Olfr1510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Olfr1510 APN 14 52410842 missense probably benign 0.04
IGL02097:Olfr1510 APN 14 52410054 missense probably benign
R0282:Olfr1510 UTSW 14 52410263 missense possibly damaging 0.94
R1449:Olfr1510 UTSW 14 52410567 missense probably damaging 1.00
R2113:Olfr1510 UTSW 14 52410296 missense probably damaging 1.00
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2870:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R2872:Olfr1510 UTSW 14 52410861 missense probably benign
R3409:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R3411:Olfr1510 UTSW 14 52410361 missense possibly damaging 0.64
R4480:Olfr1510 UTSW 14 52410308 missense probably damaging 1.00
R5292:Olfr1510 UTSW 14 52410445 missense possibly damaging 0.90
R5297:Olfr1510 UTSW 14 52410218 missense probably damaging 1.00
R5441:Olfr1510 UTSW 14 52409957 missense probably benign 0.02
R5749:Olfr1510 UTSW 14 52410504 missense probably damaging 1.00
R5872:Olfr1510 UTSW 14 52410768 missense probably damaging 1.00
R5941:Olfr1510 UTSW 14 52410068 missense probably benign 0.01
R7209:Olfr1510 UTSW 14 52410093 missense possibly damaging 0.80
R7379:Olfr1510 UTSW 14 52410261 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCCAGAAGAATGTACATGGGGC -3'
(R):5'- TGCCCCTCACTGAACAAGAG -3'

Sequencing Primer
(F):5'- TACATGGGGCGGGCATG -3'
(R):5'- GGGTAATTTTTCCCCCACATAAAC -3'
Posted On2015-01-23