Incidental Mutation 'R2873:Ptger4'
ID260430
Institutional Source Beutler Lab
Gene Symbol Ptger4
Ensembl Gene ENSMUSG00000039942
Gene Nameprostaglandin E receptor 4 (subtype EP4)
SynonymsEP4, Ptgerep4
MMRRC Submission 040461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R2873 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5206661-5244187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5234805 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 457 (R457G)
Ref Sequence ENSEMBL: ENSMUSP00000048736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047379] [ENSMUST00000120563]
Predicted Effect probably benign
Transcript: ENSMUST00000047379
AA Change: R457G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048736
Gene: ENSMUSG00000039942
AA Change: R457G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 258 1.3e-7 PFAM
Pfam:7tm_1 59 357 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120563
AA Change: R432G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112858
Gene: ENSMUSG00000039942
AA Change: R432G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 25 233 1.9e-7 PFAM
Pfam:7tm_1 34 332 8.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133966
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous targeted null mutants die shortly after birth due to failed closure of the ductus arteriosis. Survivors show decreased migration of Langerhans cells to lymph nodes, contact hypersensitivity and decreased incidence of induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
Acvr1 G A 2: 58,477,796 Q118* probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd40 T C 11: 94,333,945 V60A possibly damaging Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp13a2 T C 4: 141,002,983 I773T probably benign Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Ccdc162 G T 10: 41,655,099 T537N possibly damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd101 A T 3: 101,003,848 D831E probably benign Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Chek2 C A 5: 110,863,336 Y333* probably null Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Flnc A G 6: 29,447,543 D1115G probably damaging Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm5519 A C 19: 33,825,010 D151A possibly damaging Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Ndufs1 A G 1: 63,164,723 probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notch1 A G 2: 26,460,235 C2298R possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pms2 G A 5: 143,911,914 probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Ralgds A G 2: 28,548,769 probably null Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sgk2 A G 2: 162,994,529 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc4a4 G T 5: 89,135,764 V481L probably damaging Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Slit3 G T 11: 35,544,793 E184* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tet2 C T 3: 133,486,954 G573E probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Usp9y T A Y: 1,310,502 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Ptger4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Ptger4 APN 15 5243133 missense probably benign 0.00
IGL00848:Ptger4 APN 15 5235108 missense probably benign 0.16
IGL01309:Ptger4 APN 15 5242758 missense probably damaging 1.00
IGL02083:Ptger4 APN 15 5243174 missense probably benign 0.00
IGL03245:Ptger4 APN 15 5235107 missense probably damaging 1.00
R0369:Ptger4 UTSW 15 5243010 missense probably benign 0.06
R0427:Ptger4 UTSW 15 5242901 missense probably benign 0.25
R1399:Ptger4 UTSW 15 5234931 missense possibly damaging 0.81
R1778:Ptger4 UTSW 15 5235095 missense probably damaging 1.00
R1801:Ptger4 UTSW 15 5242800 missense possibly damaging 0.95
R2089:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2484:Ptger4 UTSW 15 5235173 missense probably benign 0.06
R4515:Ptger4 UTSW 15 5242379 missense probably damaging 1.00
R4572:Ptger4 UTSW 15 5243133 missense probably benign 0.00
R4655:Ptger4 UTSW 15 5243064 missense probably benign 0.06
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R6429:Ptger4 UTSW 15 5242997 missense possibly damaging 0.76
R6960:Ptger4 UTSW 15 5234715 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTATGTATGTCTATTGCACAGG -3'
(R):5'- AGAGAGTCGGAGGACATCTTC -3'

Sequencing Primer
(F):5'- GCACAGGATTTTATAAGATTCCCCC -3'
(R):5'- GGACATCTTCCGCCATGTC -3'
Posted On2015-01-23